Total RNA was extracted from cultured cells using GenElute (Sigma) and reverse transcribed using an all-in-one kit (ABM) with random hexamer. Quantitative PCR (qPCR) was performed using SYBR Green PCR master mix reagent (Promega) with a 7500 Fast real-time system (Applied Biosystem). The threshold cycle (Ct) value for each gene was normalized to the Ct value for 36B4. The RT-qPCR primer sequences are listed in Table S3 .
7500 fast real time system
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
The 7500 Fast Real-Time System is a thermal cycler designed for fast real-time PCR analysis. It features a Peltier-based thermal block and fast cycling capabilities to enable rapid nucleic acid detection and quantification.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (14 mentions)
Rneasy mini kit, by Qiagen (6 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Superscript 2, by Thermo Fisher Scientific (3 mentions)
Primescript rt master mix, by Takara Bio (3 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (3 mentions)
Sybr green reagent, by Thermo Fisher Scientific (2 mentions)
Taqman allelic discrimination assay, by Thermo Fisher Scientific (2 mentions)
Sensifast probe lo rox one step kit, by Meridian Bioscience (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Sybr green master mix, by Roche (2 mentions)
Tb green premix ex taq, by Takara Bio (2 mentions)
Miscript reverse transcription kit, by Qiagen (2 mentions)
Mirneasy mini kit, by Qiagen (2 mentions)
High capacity reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Gotaq qpcr master mix, by Promega (2 mentions)
Amv reverse transcriptase, by Takara Bio (2 mentions)
Digoxin high prime dna labeling and detection starter kit 1, by Roche (2 mentions)
Sybr master mix, by Thermo Fisher Scientific (2 mentions)
60 protocols using 7500 fast real time system
1
Quantitative RT-PCR Gene Expression Analysis
2
miRNA Extraction and Quantification
3
Quantitative Analysis of Ncoa7 Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from different brain areas as previously described [86 (link)] and 500 ng used for cDNA synthesis with RevertAid reverse transcriptase (Thermofisher Scientific). Real-time PCR analyses were performed using SYBR Green I Mastermix (Roche) on a 7500 Fast Real-Time System (Applied Biosystem) with the following protocol: 95 °C for 10 min; 30 s at 95 °C/20 s at the specific annealing temperature (Ta)/30 s at 72 °C for 45 cycles; melting curve (heating ramp from 55 to 95 °C) to check for amplification specificity. Each individual well used 1/100 of the original cDNA reaction. The Ncoa7 exon 3-specific primers FW 5′-CAGCTGCGTCCTCGAAGAG-3′ and Rev 5′-GCTGTAACGTTGAACTTGTCTTGTTC-3′ were used to detect Ncoa7 full-length transcripts and S16 FW 5′-TTCTGGGCAAGGAGCGATT-3′ and Rev 5′-GATGGACTGTCGGATGGCA-3′ was used as internal control.
4
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured cells with a total RNA kit (Qiagen), and cDNA was synthesized with a cDNA reverse transcription kit (Takara). The primers (forward and reverse) for ß‐actin were: 5′‐CTGGAACGGTGAAGGTGACA‐3′ and 5′‐AAGGGACTTCCTGTAACAATGCA‐3′, for DDX10 were: 5′‐GTGCGGAGCTTCAATCGCT‐3′ and 5′‐CCTGCCATTCGGGTTTCTTCA‐3′ and for IMP4 were: 5′‐GAAAACCGCCTGATTCCCACT‐3′ and 5′‐GTGGCTGGTCACACCTTCA‐3′. Quantitative real‐time PCR was performed using 7500 fast real‐time system (Thermo). The relative mRNA expressions were analyzed by the comparative Ct method and normalized by the abundance of ß‐actin.
5
Quantitative Real-Time PCR Analysis of Angiogenic Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HUVECs were seeded at a density of 3 × 105/mL into 6-well plates with complete medium or CM (HL60 or NB4 cells) for 24 h. Total RNA was isolated using the Trizol (Ambion, USA) reagent and chloroform. RNA was used for reverse-transcription to synthesise the cDNA. Quantitative real-time PCR analysis was performed using the 7500 Fast Real-Time System (Thermo Fisher Scientific, USA). The mixed reaction was composed of SYBR Green dye and master mix (Takara, Japan), forward primers, reverse primers (Invitrogen, CA, USA), and DEPC H2O. The thermal cycling conditions included the following steps: initial denaturation at 50 °C and 95 °C for 10 min each; 40 cycles of initial denaturation at 95 °C for 1 min. β-Actin was used to normalise gene expression levels. The mRNA abundance was analysed using the comparative threshold cycle (2−ΔΔCT) method. The primer sequences used included the following: actin: TCACCCACACTGTGCCCATCTACGA (F), CAGCGGAACCGCTCATTGCCAATGG(R); PI3K: TTGTTCATAGCAGCATGGTC (F), ATGGAAGACGGGAGATTCAC (R); AKT: TCACCATCACACCACCTGAC (F), CTCAAATGCACCCGAGAAAT (R); VEGF: CCCACTGAGGAGTCCAACAT (F), TCCCTTTCCTCGAACTGATT (R).
6
RNA Expression Analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from corresponding tissues and cell lines using TRIzol reagent and then synthesized into cDNA by the corresponding reverse transcription kit (Invitrogen, Carlsbad, CA, USA). Subsequently, quantitative PCR was done using SYBR Green reagent (Invitrogen) on the 7500 Fast Real-Time System (Thermo Fisher Scientific, Waltham, MA, USA) to detect the RNA expression levels. The results were standardized to GAPDH and U6. The relative quantification of indicated genes were normalized through the 2−ΔΔCt method. All genes were assayed at least in triplicate. The primer information is lists in Table 1 .
7
Quantitative Expression Analysis of XIAP and GAPDH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time quantitative PCR was performed with a 7500 FAST Real-time system (Thermo Fisher, MA, USA) using a TaqMan Universal Master Mix II with UNG according to the manufacturer’s protocol. The TaqMan primer sequences were as follows: XIAP #:4331182 ID:Hs00745222_s1, GAPDH #:4331182 ID:Hs02758991_g1.
8
Genotyping TPMT and COMT Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Previously associated variants in TPMT (rs12201199: C__31923406_10, rs1800460: C__30634116_20, rs1142345: C_____19567_20) and COMT (rs4646316: C__29193982_10, rs9332377: C__29614343_10) were genotyped using Taqman allelic discrimination assays according to the protocol of the manufacturer (Invitrogen, Bleiswijk, The Netherlands). After amplification, the fluorescent signal for allelic discrimination was determined using the 7500 Fast Real-time System (Invitrogen). Automated allele calling was performed by allelic discrimination plots using SDS 1.4 software (Invitrogen).
9
Quantifying Gene Expression in OSCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from normal and OSCC tissues and cells using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) and then synthesized into cDNA by using the Prime Script™ 1st Strand cDNA Synthesis Kit (Takara, Tokyo, Japan). Subsequently, quantitative PCR was done by using SYBR Green reagent (Invitrogen) on the 7500 Fast Real-Time System (Invitrogen) to detect the RNA expression levels. The results were standardized to GAPDH or U6. The relative quantification of the indicated genes was normalized by using the 2−ΔΔCt method. All indicators were assayed at least in triplicate. The primer information is listed in Table 1 .
10
Influenza Virus Detection by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from nasal wash as previously described [32 (link)]. A total of 4 µL RNA was assayed by real-time RT-PCR with influenza virus–specific primers and probes, using the SensiFAST Probe Lo-ROX One-Step Kit, according to the manufacturer's instructions (Bioline), on the 7500 Fast Real-Time system (Applied Biosystems). Primers and probes were from the Centers for Disease Control and Prevention (CDC) Influenza Virus Real-Time RT-PCR Influenza A (H1/H3/H1pdm09) Subtyping Panel and the CDC Influenza B Lineage Genotyping Panel, obtained from the Influenza Reagent Resource (available at: http://www.influenzareagentresource.org/ ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!