Viral burden in lung and trachea from mice were measured as described previously. Briefly, lung and trachea tissue homogenates were clarified by centrifugation at 6000 rpm for 6 min and viral RNA was extracted using the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer’s protocol. Viral burden in each tissue sample was performed by quantitative reverse transcription PCR (RT-qPCR) targeting the S gene of SARS-CoV-2. RT-qPCR was performed using the One Step PrimeScript RT-PCR Kit (Takara). The determination of the detection limit was based on the lowest level at which viral RNA was detected and remained within the range of linearity of a standard curve (Ct value of 38). RT-qPCR was performed using One Step PrimeScript RT PCR Kit (Takara, Japan) with the following primers and probes: CoV-F3 (5′-TCCTGGTGATTCTTCTTCAGGT-3′); CoV-R3 (5′-TCTGAGAGAGGGTCAAGTGC-3′); and CoV-P3 (5′-FAM-AGCTGCAGCACCAG CTGTCCA-BHQ1-3′). The 20 μl reaction mixtures were set up with 2 μl of RNA. Cycling conditions were as follows: 42 °C for 5 min, 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 20 s.
One step primescript rt pcr kit
Manufactured by Takara Bio
Sourced in Japan, China, United States, Germany
The One Step PrimeScript RT-PCR Kit is a reagent kit designed for reverse transcription and polymerase chain reaction in a single step. The kit includes all necessary components for the combined RT-PCR process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (67 mentions)
Qiaamp viral rna mini kit, by Qiagen (32 mentions)
Rneasy mini kit, by Qiagen (22 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (19 mentions)
Trizol, by Thermo Fisher Scientific (19 mentions)
Abi 7500 system, by Thermo Fisher Scientific (11 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (10 mentions)
Sybr green pcr master mix, by Takara Bio (8 mentions)
Abi 7500, by Thermo Fisher Scientific (7 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (6 mentions)
Pmd18 t vector, by Takara Bio (6 mentions)
One step sybr primescript rt pcr kit, by Takara Bio (5 mentions)
Ex taq hs, by Takara Bio (5 mentions)
Trizol reagent, by Tiangen Biotech (5 mentions)
Lightcycler 480 system, by Roche (5 mentions)
Primescript rt reagent kit, by Takara Bio (5 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Rnaiso plus reagent, by Takara Bio (5 mentions)
Lightcycler 480, by Roche (5 mentions)
Sybr premix dimmer eraser kit, by Takara Bio (5 mentions)
415 protocols using one step primescript rt pcr kit
1
SARS-CoV-2 Viral Load Quantification
2
Sensitive Detection of Simian Enterovirus gx in Rhesus Macaques
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The presence of SEV-gx was confirmed in 280 faecal samples from Macaca mulatta by reverse transcription nested PCR (RT-nested PCR) with PrimeScript One Step RT-PCR Kit (Takara, Tokyo, Japan), based on the sequences obtained by Miseq sequencing. Complete VP1 sequences were amplified for the SEV-gx-positive samples, using PrimeScript One Step RT-PCR Kit (Takara). All of the amplifications were achieved under the following conditions: 50 °C for 30 min, and 94 °C for 5 min, followed by 35 cycles (94 °C for 30 s, 53 °C for 30 s and 72 °C for 1 min) and then 72 °C for 7 min. The RT-PCR products were electrophoresed and purified on a 1.5% agarose gel. The sequences were determined using the Big-Dye terminator cycle sequencing kit and the ABI Prism 310 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). All of the primers used are listed in Table S1 .
3
Quantitative TSWV detection in plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Virus-inoculated plants were maintained and monitored for symptom expression up to 35 dpi. TSWV-inoculated leaf tissues were collected at 4, 7, 14, 21 and 35 dpi, respectively. For sample collection, a small piece of leaf tissue (500 mg) from inoculated leaf (Sw-7 and S-line) was collected at 4 dpi and subsequent collections were performed on systemic young leaf at other time points (7, 14, 21 and 35 dpi). Inoculated plants were tested to confirm for the presence and concentration of TSWV using real-time RT-qPCR52 (link). RT-qPCR was performed using the TaqMan probe 5′HEX-AAATCTAAGATTGCTTCCCACCCTTTGATTCAA-BHQ, with forward primer 5′GCTTGTTGAGGAAACTGGGAATT and reverse primer 5′AGCCTCACAGACTTTGCATCATC52 (link) located in the N gene of TSWV and Takara One Step PrimeScript RT-PCR Kit (Clontech, USA) following manufacturer’s instructions. The One-step RT-qPCR reaction was carried out on a Stratagene MX3000P Real-Time PCR machine (Agilent, USA), under the following conditions: 50 °C for 30 min, denaturation at 95 °C for 2 min, followed by 40 cycles of 95 °C for 1 min and 55 °C for 30 sec.
4
Quantifying CD22ΔE12 Transcript Levels
5
Multiplex RT-qPCR for Arboviruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA samples were denatured at 95 °C and quickly cooled on ice, and then subjected to testing by reverse transcript-quantitative polymerase chain reaction (RT-qPCR). For each sample, 20 μL of reaction solution was prepared using One Step PrimeScriptTM RT-PCR kit (Takara, Dalian, China) according to the manufacturer’s instructions, and 4 μL of RNA template, 0.4 μL of each primer and 0.8 μL of probe were added (Table S1 ). These primers and probes were against Akabane virus (AKAV), BAV, BTV, EHDV, Palyam virus (PALV), and TIBOV, respectively (Table S1 ). The RT-qPCR was performed on a 7500 Fast Real-time PCR machine (Applied Biosystems, Carlsbad, CA, USA) under the following cycling conditions: 45 °C, 5 min; 95 °C, 10 s; then 95 °C/5 s, 60 °C/34 s for 40 cycles. Fluorescence was measured at the end of each extension step.
6
Quantification of Zika Virus RNA Strands
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The viral RNA was extracted from cell-culture supernatants using the the PureLink® RNA Mini Kit (Life technologies, USA) and the total RNA of intracellular was using Trizol reagent (Invitrogen) according to the manufacturer’s instructions. Using virus-specific primers and probe were described previously [8 (link)], RT-qPCR was carried out with the One-Step PrimeScriptTM RT-PCR Kit (Takara, Dalian, China). For quantification of ZIKV genomic RNA of both positive- and negative-strands in different cells, the intracellular total RNA by strand-specific RT-PCR using the 5’-tagged forward (ZIKV-ASF-Tag) and reverse (ZIKV-ASR-Tag) primers as described previously [8 (link)]. Quantitative PCR (qPCR) was then performed with the specific primers and probe for strand specific RNA detection. All the experiments were performed with the CFX Connect™ Real-Time PCR Detection System (Bio-Rad)
7
ZIKV RNA Quantification by One-Step RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed with RNA lysis buffer, and RNA was extracted using the QIAamp® Viral RNA Mini Kit (QIAGEN, 52906) according to the manufacturer’s instructions. RNA quantification in each sample was performed by targeting the NS5 gene of ZIKV. ZIKV RNA was quantified by a One-Step PrimeScriptTM RT–PCR Kit (Takara, RR064A) with the following primers and probes: ZIKV-NS5-ASF (5′-GGTCAGCGTCCTCTCTCTAATAAACG-3′); ZIKV-NS5-ASR (5′-GCACCCTAGTGTCCACTTTTTCC-3′); and ZIKV-NS5-Probe (5′-AGCCATGACCGACACCACCCGT-3′).
8
Multiplex RT-qPCR for Hantavirus Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate the performance of the multiplex RT-LAMP assay, a multiplex RT-qPCR assay was established for simultaneously detecting HTNV and SEOV according to a previously described multiplex RT-qPCR assay [24 (link)]. The primers and probes were modified from the previous paper and are shown in Table 1 . The multiplex RT-qPCR reaction was performed using a One-Step Prime ScriptTM RT-PCR Kit (Takara, Dalian, China) in a CFX 1000 Touch Real-Time PCR Detection System (Bio-Rad Laboratories, USA). The 25 μL mixture contained 12.5 μL of 2× One-Step RT-PCR buffer, 0.5 μL of Ex Taq HS (5 U/μL), 0.5 μL of PrimeScript RT enzyme mix, 0.4 mΜ each of HASE-F and -R, 0.25 μM HTNV-P/SEOV-P, and 3 μL template. Reactions were incubated at 42 °C for 5 min and then 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Samples were considered positive if they had a Ct value less than 40 [32 (link)].
9
Cardiac Gene Expression Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the heart tissues or primary cardiomyocytes using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and reverse transcribed into cDNA using a One Step PrimeScriptTM RT-PCR Kit (Takara Bio, Inc.) according to the manufacturers' instructions. RT-qPCR analysis was performed using LightCycler 480 SYBR Green 1 Master Mix (No. 04707516001; Roche Diagnostics) according to the manufacturers' protocol. The relative mRNA expression was normalized to that of GAPDH using the 2-∆∆Cq method (17 (link)). The sequences of the primers (Sangon Biotech Co., Ltd.) were as follows: GAPDH forward, 5'-TCATCAACGGGAAGCCCATC-3', reverse, 5'-CTCGTGGTTCACACCCATCA-3'; ANP forward, 5'-ACCTGCTAGACCACCTGGAG-3', reverse, 5'-CCTTGGCTGTTATCTTCGGTACCGG-3'; BNP forward, 5'-GAGGTCACTCCTATCCTCTGG-3', reverse, 5'-GCCATTTCCTCCGACTTTTCTC-3'; β-MHC forward, 5'-CCGAGTCCCAGGTCAACAA-3', reverse, 5'-CTTCACGGGCACCCTTGGA-3'; AMP-activated protein kinase (AMPK) forward 5'-TCAAGCCCAGGACAGGATTT-3', reverse, 5'-CTCTTGCGTCTCCCGACTTG-3'; acetyl-CoA carboxylase (ACC) forward, 5'-CCTGGTTCCCTGCTTACCTG-3', reverse, 5'-GTGGGATTGGACGTGCTGTA-3'; and mechanistic target of rapamycin (mTOR) forward 5'-AGAGGTCGGCACTCCACTAT-3' and reverse, 5'-TGGCCAGGCTTCTGAACAAA-3'.
10
SARS-CoV-2 RNA Detection by Q-RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the QIAamp Viral RNA Mini kit (Qiagen, Germantown, MD, USA) and detected using the One Step PrimeScriptTM RT-PCR Kit (TaKaRa, Japan) according to the manufacturers’ protocol. Quantitative real-time PCR (Q-RT-PCR) assays were performed by using a set of primers and probes, targeting regions of the N gene [For GX/P2V, Forward: 5′-AGGTGACGAGGTTAGACAAATAG-3′; Reverse: 5′-CCAAGCAATAACACAACCAGTAA-3′; Probe: FAM-5′-ACCCGGACAAACTGGTGTTATTGCT-3′-TAMRA. For V34, Forward: 5′-GGGGAACTTCTCCTGCTAGAAT-3′; Reverse: 5′-CAGACATTTTGCTCTCAAGCTG-3′; Probe: FAM-5′-TTGCTGCTGCTTGACAGATT-3′-TAMRA], and the PCRs were run on the ABI 7500 System (ThermoFisher, Waltham, MA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!