Log In Sign up
The largest database of trusted experimental protocols

Nucleofection

Manufactured by Lonza
Visit Supplier
Sourced in United States, Switzerland, Germany, China

Nucleofection is a transfection technology that enables the efficient and gentle delivery of nucleic acids into difficult-to-transfect cells, such as primary cells and stem cells. The technology uses a specialized buffer and electrical pulses to facilitate the uptake of DNA, RNA, or other molecules into the cells' nucleus.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (10 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (5 mentions) Puromycin, by Merck Group (5 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (4 mentions) Facsaria cell sorter, by BD (3 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (3 mentions) Glutamax, by Thermo Fisher Scientific (3 mentions) Neurobasal medium, by Thermo Fisher Scientific (2 mentions) Px459, by Addgene (2 mentions) Xfect, by Takara Bio (2 mentions) Facsaria 3, by BD (2 mentions) Pcdna3, by Thermo Fisher Scientific (2 mentions) Non targeting sirna, by Qiagen (2 mentions) Trypsin, by Thermo Fisher Scientific (2 mentions) Puseamp containing a myc tag, by Merck Group (2 mentions) Pcdna3.1 s1pr1, by OriGene (2 mentions) Pcmv6 sphk1, by OriGene (2 mentions) Lipofectamine, by Thermo Fisher Scientific (2 mentions) 2 primary cell 4d nucleofector x kit, by Lonza (2 mentions) Collagenase 1, by Worthington (2 mentions)

Close spelling variants of this product

P3 primary cell nucleofection buffer (2 citations) Nucleofection buffer (4 citations) Nucleofection strip (2 citations) Human T cell nucleofection reagents (2 citations) P3 primary nucleofection solution (3 citations) P3 nucleofection solution (6 citations) Lonza nucleofection buffer P2 (3 citations) Monocyte Amaxa Nucleofection kit (2 citations) Amaxa nucleofection protocol (2 citations) Human monocyte nucleofection kit (6 citations)

130 protocols using nucleofection

1

Investigating Vps34 Regulation by AGGF1

Check if the same lab product or an alternative is used in the 5 most similar protocols
HUVECs were transfected with an expression plasmid for HA-tagged Vps34 using nucleofection (Lonza) and then incubated with different amounts of AGGF1 or control IgG. Exogenous Vps34 expressed in HUVECs was immunoprecipitated using an anti-HA antibody, measured using the class III PI3K assay, and was carried out using the Class III PI3-kinase ELISA kit (Echelon, UT, US).
HUVECs were transfected with an overexpression plasmid for pGFP-2xFYVE by nucleofection (Lonza). Twenty-four hours later, HUVECs were treated with or without JNK inhibitors for 1 h and then incubated with AGGF1 for 12 h. Images were captured with a florescence microscope and analyzed for the number of green GFP-FYVE dots with endocytic membrane Vps34 per cell.
Lu Q., Yao Y., Hu Z., Hu C., Song Q., Ye J., Xu C., Wang A.Z., Chen Q, & Wang Q.K. (2016). Angiogenic Factor AGGF1 Activates Autophagy with an Essential Role in Therapeutic Angiogenesis for Heart Disease. PLoS Biology, 14(8), e1002529.
+ Open protocol
+ Expand
2

Surveyor Nuclease Assay for CRISPR Editing

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
A surveyor nuclease assay was performed as previously described (Fachinetti et al. 2015 (link)). Briefly, 1*106 U2OS cells were transfected with 1000 ng of the sgRNA/Cas9 expression vector by nucleofection (Lonza) using program X-001 and a nucleofection buffer (100 mM KH2PO4, 15 mM NaHCO3, 12 mM MgCl2, 6 H20, 8 mM ATP, 2 mM glucose, pH 7.4). 48 hours following transfection, genomic DNA was isolated using the quick g-DNA miniprep isolation kit (Zymo) and PCR was performed using Q5 polymerase (NEB) with CENP-A specific primers sitting just outside of the target sequence (forward primer: 5’ GACTTCTGCCAAGCACCG 3’; reverse primer: 5’ GCCTCGGTTTTCTCCTCTTC 3’). PCR products were denatured, annealed, treated with the surveyor nuclease (Transgenomics), separated on a 10% TBE polyacrylamide gel and visualized by ethidium bromide staining.
Hoffmann S., Dumont M., Barra V., Ly P., Nechemia-Arbely Y., McMahon M.A., Hervé S., Cleveland D, & Fachinetti D. (2016). CENP-A is dispensable for mitotic centromere function after initial centromere/kinetochore assembly. Cell reports, 17(9), 2394-2404.
+ Open protocol
+ Expand
3

Investigating Wnt Signaling in EPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
To investigate Wnt signalling in EPSCs, 1.0 × 106 cells were seeded in M15, N2B27-2i/LIF, KSR-2i/LIF and EPSCM for 48 h. Cytoplasmic and nuclear proteins were extracted with a NE-PER Nuclear and Cytoplasmic Extraction Kit (Thermo Scientific) for western blot to detect phospho-β-catenin (Cell Signaling), β-catenin (Sigma) and active-β-catenin (Millipore). α-Tubulin (Abcam) and histone H3 were used as loading controls for cytoplasmic and nuclear protein, respectively. For the TOPflash assay, 2.0 × 106 cells were co-transfected with 20 μg TOPflash and 2 μg pRL-TK by Nucleofection (Amaxa). Cells were split 1:9 into a 24-well plate in M15and N2B27-2i/LIF and EPSCM for 48 h. Cell lysates were prepared for luciferase assay. Antibodies used are listed in Supplementary Table 7.
Yang J., Ryan D.J., Wang W., Tsang J.C., Lan G., Masaki H., Gao X., Antunes L., Yu Y., Zhu Z., Wang J., Kolodziejczyk A.A., Campos L.S., Wang C., Yang F., Zhong Z., Fu B., Eckersley-Maslin M.A., Woods M., Tanaka Y., Chen X., Wilkinson A.C., Bussell J., White J., Ramirez-Solis R., Reik W., Göttgens B., Teichmann S.A., Tam P.P., Nakauchi H., Zou X., Lu L, & Liu P. (2017). Establishment of mouse expanded potential stem cells. Nature, 550(7676), 393-397.
+ Open protocol
+ Expand
4

Retrotransposition Assays in Stem Cells

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Retrotransposition assays in HeLa-JVM cells were conducted as described (Wei et al. 2000 (link)). H9-hESCs, MSCs, hESC-derived MSCs, hESC-derived NPCs, MSCs, and HFFs were transfected by Nucleofection (Amaxa) as previously described (Garcia-Perez et al. 2007 (link); Coufal et al. 2009 (link); Wissing et al. 2012 (link)). hESC-derived neurons were transfected using the AD1 Primary Cell 4D-Nucleofector Y Kit (Lonza) and program EH-158. Briefly, 1 × 105 hESC-derived NPCs were differentiated during 31 d (Coufal et al. 2009 (link); Muotri et al. 2010 (link)); next, adhered mature neuronal cells were transfected with 15 µg of the indicated plasmid using Nucleofection in the presence of 4 µM BrdU (Sigma). After transfection, hESC-derived neurons were fed with a 1:1 mixture of the collected NB-conditioned media and fresh NB media supplemented with 10 µM iRock (Y-27632, Sisma) and 4 µM BrdU during 5 d. L1-EGFP-expression was next monitored by immunostaining. Additional transfection experiments of hESC-derived neurons were conducted using a CalPhos Mammalian Transfection Kit (Clontech) and following the manufacturer's instructions using 1 µg of each plasmid DNA in 24-well tissue culture plates containing differentiated neurons at day 31.
Macia A., Widmann T.J., Heras S.R., Ayllon V., Sanchez L., Benkaddour-Boumzaouad M., Muñoz-Lopez M., Rubio A., Amador-Cubero S., Blanco-Jimenez E., Garcia-Castro J., Menendez P., Ng P., Muotri A.R., Goodier J.L, & Garcia-Perez J.L. (2017). Engineered LINE-1 retrotransposition in nondividing human neurons. Genome Research, 27(3), 335-348.
+ Open protocol
+ Expand
5

Transcriptional Regulation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
GSCs were co-transfected with 1 μg of pGL2-MAP2 promoter construct12 (link) and 50 ng of pRSV-β-gal by nucleofection (Amaxa, Cologne, Germany). Cells were also transfected with 1 μg of pBVIx-Luc, a plasmid containing NFκB consensus sequences linked to the luciferase reporter gene. Luciferase activity was analysed by a dual-light reporter gene assay (Applied Biosystems). Results were normalized by cotransfection with pRSV-β-gal.
Ferrandez E., Gutierrez O., Segundo D.S, & Fernandez-Luna J.L. (2018). NFκB activation in differentiating glioblastoma stem-like cells is promoted by hyaluronic acid signaling through TLR4. Scientific Reports, 8, 6341.
+ Open protocol
+ Expand
6

Isolation and Culture of Rat Hippocampal Neurons

Check if the same lab product or an alternative is used in the 5 most similar protocols
Medium-density hippocampal neurons were prepared from E18 rat embryos and maintained in Neurobasal medium (Invitrogen) containing B-27 supplement (Invitrogen). For Co-IP or biotinylation, dissociated hippocampal neurons were plated on 10 cm dishes coated with poly-l-lysine (PLL); and experiments were done on 14 days in vitro (DIV). For electrophysiology recordings, dissociated hippocampal neuron cultures were plated on glass coverslips coated with PLL and transfected with the plasmids using ProFection® Mammalian Transfection System (Promega) on 11 DIV; and electrophysiological recordings were performed on 13–14 DIV.
For immunostaining surface GluA1 or GluA2, cultured hippocampal neurons were prepared from embryonic day 18. The hippocampal cells were plated on glass coverslips coated with PLL at a density of 300,000 per 60 mm dish. The coverslips were inverted over a feeder layer of astrocytes in Neurobasal medium (Invitrogen) supplemented with B27 (Invitrogen). Cytosine arabinoside (5 μM) was added to neuron culture dishes on 3 DIV to prevent overgrowth of glial cells. Neurons were transfected with YFP-p2a-p97 or YFP as control before plating using nucleofection (AMAXA Biosystems), and immunostaining was performed on 14 DIV.
Ge Y., Tian M., Liu L., Wong T.P., Gong B., Wu D., Cho T., Lin S., Kast J., Lu J, & Wang Y.T. (2019). p97 regulates GluA1 homomeric AMPA receptor formation and plasma membrane expression. Nature Communications, 10, 4089.
+ Open protocol
+ Expand
7

Targeted siRNA Silencing of THY-1 in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
THY-1 specific siRNA SmartPools (M-015337-00) and non-specific control pools (Duplex-13), THY-1 single siRNA oligos with targeting sequences CAACUUCACCAGCAAAUAC (THY-1-02) and GGACUGCCGCCAUGAGAAU (THY-1-04), and non-targeting single oligo #4 were obtained from Dharmacon (Lafayette, CO). Cells were transfected with siRNAs (125 pmol per 2 x 106 cells) using nucleofection (Amaxa, Gaithersburg, MD) for 48 hr before infection or harvesting.
Li Q., Wilkie A.R., Weller M., Liu X, & Cohen J.I. (2015). THY-1 Cell Surface Antigen (CD90) Has an Important Role in the Initial Stage of Human Cytomegalovirus Infection. PLoS Pathogens, 11(7), e1004999.
+ Open protocol
+ Expand
8

Transfection of Chondrocytes with EZH2 Expression Vector

Check if the same lab product or an alternative is used in the 5 most similar protocols
EZH2 expression vector (pEZH2) was a gift from Kristian Helin (Addgene plasmid #24,230)35 (link). Plasmids were transfected in cells using nucleofection (Amaxa), according manufacturer’s protocol. Briefly, chondrocytes were harvested. Then, 4 millions of cells were mixed with 8 µg of DNA (pEZH2 or empty vector) in P3 Primary Cell 4D-Nucleofector X Solution, and placed in a 1 cm2 transfection cuvettes to be electroporated using 4D-Nucleofector X Unit. The ER-100 predefined program was used. After nucleofection, cells were plated in appropriated dishes and incubated in culture medium.
pMax-GFP (Amaxa), an expression vector for Green Fluorescent Protein, was used to evaluate transfection efficiency. The percentage of transfected cells, corresponding to green fluorescent cells, were assayed by flow cytometry. Viability was evaluated by counting adherent cells after blue trypan exclusion.
Allas L., Brochard S., Rochoux Q., Ribet J., Dujarrier C., Veyssiere A., Aury-Landas J., Grard O., Leclercq S., Vivien D., Ea H.K., Maubert E., Cohen-Solal M., Boumediene K., Agin V, & Baugé C. (2020). EZH2 inhibition reduces cartilage loss and functional impairment related to osteoarthritis. Scientific Reports, 10, 19577.
+ Open protocol
+ Expand
9

Transient Cell Transfection Optimization

Check if the same lab product or an alternative is used in the 5 most similar protocols
EpS15 mutant constructs (pEGFP-C2-EH29, pEGFP-C2-DIII and pEGFP-C2-D3▲) and pCDNA3-GFP-Cbl construct were obtained as a gift from Dr. Mayumi Naramura (University of Nebraska Medical Center, Omaha, NE). pRK5-HA-Ubquitin-WT construct was purchased from Addgene (Cambridge, MA). Transfections were performed by Nucleofection (Amaxa Biosystems, Inc., Gaithersburg, MD). 1 x 106 to 5 x 106 cells were washed with PBS once and resuspended in 100 μl of Nucleofector Solution V and mixed with 2-5 μg of plasmid DNA. The cell/DNA mixture was then transferred to an Amaxa-certified cuvette and subjected to Nucleofection using a preexisting program (U-024) on the nucleofector device. Immediately after Nucleofection, 500 μl of medium was added to the cuvette and transfected cells were transferred to a culture dish containing pre-warmed complete growth medium using an Amaxa-certified Pasteur pipette and incubated in a humidified CO2 incubator at 37°C. Analysis of gene expression was done by FN matrix assembly, immunoblot analysis, and immunofluorescence using an inverted microscope (Nikon Eclipse TE 300, Melville NY). Transfection efficiency of the cells was analyzed by FACS Calibur (Becton & Dickenson, San Jose, CA). Supplier-provided pMax-GFP DNA, non-transfected cells, and/or empty vector were used as controls.
Hsia H.C., Nair M.R, & Corbett S.A. (2014). THE FATE OF INTERNALIZED α5 INTEGRIN IS REGULATED BY MATRIX-CAPABLE FIBRONECTIN. The Journal of surgical research, 191(2), 268-279.
+ Open protocol
+ Expand
10

Culturing and Transfecting MIN6 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MIN6 cells between passage 40-60 were utilized (obtained from J. Miyazaki [52 (link)]). Cells were maintained in 25 mM glucose Dulbecco’s modified eagle medium (DMEM) (Life Technologies, Frederick, MD) supplemented with 10% fetal bovine serum (FBS), 0.001% β-mercaptoethanol, 100 U/ml penicillin, and 0.1 mg/ml streptomycin in 5% CO2 at 3710. MIN6 cells were transfected using Nucleofection (Amaxa).
RPE1-hTert cells were maintained in DMEM/F12 with 10% FBS and grown at 371°C with 5% CO2.
Trogden K.P., Zhu X., Lee J.S., Wright C.V., Gu G, & Kaverina I. (2019). Regulation of glucose-dependent Golgi-derived microtubules by cAMP/EPAC2 promotes secretory vesicle biogenesis in pancreatic β-cells. Current biology : CB, 29(14), 2339-2350.e5.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!