Quantstudio 6 detection system

Manufactured by Thermo Fisher Scientific

Sourced in United States

The QuantStudio 6 Detection System is a real-time PCR instrument designed for sensitive and accurate gene expression analysis. It features a compact footprint and supports a variety of sample formats, enabling researchers to perform high-throughput nucleic acid quantification experiments.

Automatically generated - may contain errors

Lab products found in correlation

High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions) Sybr green pcr mix, by Takara Bio (1 mentions) Hifair 3 1st strand cdna synthesis supermix, by Yesen (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Abi sybr green master mix, by Thermo Fisher Scientific (1 mentions) Primescript rt master mix for rt pcr, by Takara Bio (1 mentions) Trizol reagent, by Takara Bio (1 mentions) Reverse transcription kit, by Takara Bio (1 mentions) Sybr green, by Thermo Fisher Scientific (1 mentions) Rnaiso reagent, by Takara Bio (1 mentions) Rneasy purification kit, by Qiagen (1 mentions) Sybr green master mix, by Thermo Fisher Scientific (1 mentions) Dneasy blood and tissue kit, by Qiagen (1 mentions) Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions) Faststart universal sybr green master mix with rox, by Roche (1 mentions) M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Power sybr green, by Thermo Fisher Scientific (1 mentions) Moloney murine leukemia virus reverse transcriptase, by Thermo Fisher Scientific (1 mentions)

7 protocols using quantstudio 6 detection system

Quantitative Gene Expression Analysis in Bermudagrass

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each treatment, three biological replicates were taken from different potted plants. Trizol reagent (Invitrogen, America) was used to isolated total RNA from about 0.1 g samples of leaves and roots. DNasel was used to remove contaminating genomic DNA from RNA. A UV spectrophotometry NanoDrop was used to examine the RNA concentration and purity (Thermo Fisher Scientific, Lenexa, Ks, USA). Using a Hifair III 1st Strand cDNA Synthesis SuperMix for qPCR with genome-DNA-removing enzyme, 2.5 ug RNA was reverse transcribed to cDNA (Yesen, Nanjing, China). The qPCR was carried out on a Quant Studio 6 detection system (ABI, Forster City, CA, USA) with a SYBR green PCR mix (Takara, RR420A, Shika, Japan). The following was the real-time PCR program: 95°C for 5 minutes; 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds. Table 2 contains a list of primers. For gene expression level analysis, the bermudagrass Actin gene was used as an inner control, and the comparative Ct method was used.

Zhou X., Yin Y., Wang G., Amombo E., Li X., Xue Y, & Fu J. (2022). Mitigation of salt stress on low temperature in bermudagrass: resistance and forage quality. Frontiers in Plant Science, 13, 1042855.

+ Open protocol

+ Expand

Quantifying siRNA Encapsulation in EVs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Encapsulation of siRNA in EVs was analyzed by real-time quantitative reverse transcription PCR. After electroporation and purified by ultracentrifugation, RNA of EV samples or naked siRNA were isolated using TRIzol reagent(TaKaRa) according to manufacturer's instructions. A total of 250 fmol of synthetic Caenorhabditis elegans miRNA cel-miR-39 (RiBoBio, Guangzhou, China) was added to each sample as an internal control. Reverse transcription of samples using PrimeScript RT Master Mix for RT-PCR (TaKaRa) by specific reverse stemloop primers (RiBoBio, Guangzhou, China). Real-time PCR performed using ABI SYBR Green Master Mix (Life Technologies) on ABI QuantStudio 6 Detection System. All reactions were carried out using 2^-ΔΔCt method.

Fu Y, & Xiong S. (2021). Tagged extracellular vesicles with the RBD of the viral spike protein for delivery of antiviral agents against SARS-COV-2 infection. Journal of Controlled Release, 335, 584-595.

+ Open protocol

+ Expand

Isolation and Quantification of Extracellular RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells, microvesicles, and purified exososmes isolation described above was resuspended in RNAiso reagent (TaKaRa, #9108) for total RNA isolation following the manufacturer's instructions. The resulting RIN (RNA integrity number) scores and concentrations were considered when qualifying samples to proceed. The small RNA library construction and deep sequencing were described in previous study.¹³For copy number analysis of microRNA in microvesicles or purified exosomes, RNA was reverse transcribed using a reverse‐transcription kit (TaKaRa, #RR047A) according to the manufacturer's instructions. cDNA was mixed with SYBR Green (Applied Biosystems) and specific primers of miRNA (RiBoBio, Guangzhou, China). The synthetic miRNA fragments input ranged from 1 fM to 100 pM to generate standard curves and reactions were run on ABI QuantStudio 6 Detection System.

Fu Y, & Xiong S. (2023). Differential traits between microvesicles and exosomes in enterovirus infection. MedComm, 4(5), e384.

+ Open protocol

+ Expand

Genomic and Transcriptomic Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA and total RNA were extracted using standard procedures with the DNeasy Blood and Tissue Kit or the RNeasy Purification Kit, respectively (Qiagen). DNA and RNA were quantified by spectrophotometry. cDNA was generated from 1 μg of total RNA using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific). PCR and RT-PCR amplification were performed using Q5 High-Fidelity DNA Polymerase (NEB). qRT-PCR was performed in 384-well plates with 2x SYBR Green Master Mix (Applied Biosystems) using a QuantStudio 6 Detection System (Applied Biosystems). Expression levels were normalized to the housekeeping genes ALBUMIN for genomic DNA PCR and GAPDH for RT-PCR or GUSB for qRT-PCR. The primers used are listed in Supplementary Table 1.

Martinez-Lage M., Torres-Ruiz R., Puig-Serra P., Moreno-Gaona P., Martin M.C., Moya F.J., Quintana-Bustamante O., Garcia-Silva S., Carcaboso A.M., Petazzi P., Bueno C., Mora J., Peinado H., Segovia J.C., Menendez P, & Rodriguez-Perales S. (2020). In vivo CRISPR/Cas9 targeting of fusion oncogenes for selective elimination of cancer cells. Nature Communications, 11, 5060.

+ Open protocol

+ Expand

Cardiac Gene Expression Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from human SAN and right atria tissue with the RNeasy Mini Kit (Qiagen) using deoxyribonuclease on column digestion according to the manufacturer’s protocol. Two micrograms of total RNA was used for complementary DNA (cDNA) synthesis in 50-μl reaction volume with MMLV reverse transcriptase (Life Technologies) with poly-T primers. For synthesis of each cDNA, template control for the detection of possible contamination and RT control for tracing of possible genomic DNA presence were not used. RT-qPCR was performed on QuantStudio 6 Detection System (Applied Biosystems) with 384-well platform. The reaction was performed with FastStart Universal SYBR Green Master Mix with ROX (Roche) using the manufacturer’s recommended conditions. The size of the amplicon was verified, and a dissociation curve was obtained. Each well contained 0.5 μl of cDNA solution and 10 μl of reaction mixture. Each sample was quadruplicated and repeated twice using de novo synthesized cDNA sets. RT-qPCR analysis was performed using ΔΔC_t method. Expression levels of HCN4 transcript were normalized to expression of S18. Primers for HCN4 amplification were as follows: ACGTGTGCGGTCTAGTTTAATCC (forward) and AGAACGTCCCTAGACCATGCA (reverse); for RPS18, CAGCCAGGTCCTAGCCAATG (forward) and CCTCTATGGGCCCGAATCTT (reverse).

Tsutsui K., Monfredi O.J., Sirenko-Tagirova S.G., Maltseva L.A., Bychkov R., Kim M.S., Ziman B.D., Tarasov K.V., Tarasova Y.S., Zhang J., Wang M., Maltsev A.V., Brennan J.A., Efimov I.R., Stern M.D., Maltsev V.A, & Lakatta E.G. (2018). A coupled-clock system drives the automaticity of human sinoatrial nodal pacemaker cells. Science signaling, 11(534), eaap7608.

+ Open protocol

+ Expand

RNA Isolation and Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using a Quick-RNA kit (Zymo Research, Irvine, CA) and tested for quality on a Bioanalyzer (Agilent Technologies, Santa Clara, CA). RNA concentrations were determined with a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA). RNA was reverse transcribed using Moloney murine leukemia virus reverse transcriptase (Thermo Fisher Scientific, Waltham, MA) and a mixture of anchored oligo-dT and random decamers (Integrated DNA Technologies, Coralville, IA). Two reverse-transcription reactions were performed for each sample using either 200 or 50 ng of input RNA in a final volume of 50 μl. Aliquots (2 μl) of the cDNA were used to measure the expression levels of the genes with the primers listed in Supplementary Table 4, and Power SYBR Green or Taqman Universal master mix (Thermo Fisher Scientific Waltham, MA), on a QuantStudio6 detection system (Thermo Fisher Scientific Waltham, MA). Cycling conditions were 95°C, 15 min, followed by 40 (two-step) cycles (95°C, 15 s; 60°C, 60 s). Ct (cycle threshold) values were converted to quantities (in arbitrary units) using a standard curve (four points, four-fold dilutions) established with a calibrator sample. Values were normalized to those for mRNA encoding the ribosomal protein 36B4.

Kiseleva A.A., Korobeynikov V.A., Nikonova A.S., Zhang P., Makhov P., Deneka A.Y., Einarson M.B., Serebriiskii I.G., Liu H., Peterson J.R, & Golemis E.A. (2019). Unexpected activities in regulating ciliation contribute to off-target effects of targeted drugs. Clinical cancer research : an official journal of the American Association for Cancer Research, 25(13), 4179-4193.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Dnm1l

Check if the same lab product or an alternative is used in the 5 most similar protocols

For RT-PCR, 1 µg of total RNA was converted to complementary DNA (cDNA) using iScript Reverse Transcription Supermix (Bio-Rad). qPCR was conducted on a QuantStudio 6 detection system (Thermo Fisher Scientific) using TaqMan assays and TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific). The Taqman assays employed were Dnm1l (mouse, assay ID: Mm01342903_m1, Thermo Fisher Scientific) and Gapdh (mouse, assay ID: Mm99999915_g1, Thermo Fisher Scientific). Gapdh served as the internal control. The reaction conditions were as follows: 50 °C for 2 min, 95 °C for 2 min and 40 cycles of 95 °C for 1 s and 60 °C for 20 s. Relative quantification was performed using the 2^−ΔΔCT method.

Fan R.Z., Sportelli C., Lai Y., Salehe S.S., Pinnell J.R., Brown H.J., Richardson J.R., Luo S, & Tieu K. (2024). A partial Drp1 knockout improves autophagy flux independent of mitochondrial function. Molecular Neurodegeneration, 19, 26.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!