According to the privious study 6 (link), 7 (link), 18 (link), 19 (link), SPIONs were purchased from NOVOBIO (NOVOBIO Biotechnology Co., Ltd., Shanghai, China). According to the manufacturer's instructions and previously published methods, 5 μl of 0.2 mM SPIONs was thoroughly mixed with 5 μl of 1.0 or 10 μM miR-485-5p oligonucleotide RNA (CUUAAGUAGUGCCGGUCGGAGA) (Sigma-Aldrich) or miR-mut (CUUAAGUAGUGCCGGUgccucc), vortexed for 10 s, and then maintained at room temperature for 20 min. A total of10 μl of the microRNA@SPIONs mixture was then combined with 90 μl of DMEM:F12 (1:1) serum-free medium, added to 1 x 104 cells/ml, and incubated for 72 h at 37 °C in 5% CO2.
Spions
Manufactured by Merck Group
Sourced in United States
SPIONs (Superparamagnetic Iron Oxide Nanoparticles) are a class of nanomaterials composed of iron oxide cores. They exhibit superparamagnetic properties, allowing them to be magnetized in the presence of an external magnetic field and to return to a non-magnetized state when the field is removed. SPIONs can be used in various laboratory applications due to their unique physical and chemical characteristics.
Automatically generated - may contain errors
Lab products found in correlation
Mir mut, by Merck Group (2 mentions)
Penicillin streptomycin pen strep, by Merck Group (1 mentions)
Foetal bovine serum (fbs), by Merck Group (1 mentions)
Mia paca 2, by Merck Group (1 mentions)
Potassium ferrocyanide, by Merck Group (1 mentions)
Hydrochloric acid (hcl), by Merck Group (1 mentions)
Toluene, by Merck Group (1 mentions)
6 protocols using spions
1
Targeted miRNA Delivery via SPIONs
2
In Vitro Evaluation of SPION Effects
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
6 human cancer cell lines were selected to be investigated in vitro; H460 (large cell lung cancer), MiaPaCa2 (pancreatic carcinoma), DU145 (prostate carcinoma), MCF7 (breast adenocarcinoma), U87 (brain glioblastoma) and HEPG2 (liver carcinoma). All cell lines were acquired from the American Type Culture Collection (ATCC), and were routinely tested for mycoplasma. All cell lines have also been authenticated by ATCC using Short Tandem Repeat (STR) Screening. Cells were incubated at 37 °C in 5% CO2, and all tissue culture was performed in a Class II laminar flow cabinet (Thermo, US). All cell lines, except for MiaPaCa2, were cultured in Dulbecco’s Modified Eagle Media (DMEM) (Sigma, US), supplemented with 10% Foetal Bovine Serum (FBS) (Sigma, US) and 1% Penicillin Streptomycin (Pen-Strep) (Sigma, US). MiaPaCa2 cells were incubated in High Glucose DMEM media, supplemented with 10% FBS, 1% Pen-Strep, and 0.2% Sodium Pyruvate. Cells were passaged every 2–3 days to maintain exponential grown.
NPs used for this study were SPIONs with a 5 nm diameter, acquired from Sigma, US (product number 725331), suspended in H2O at a concentration of 5 mg/ml, with the molecular weight of Fe3O4 being 231.53 g/mol. For the purpose of this study, all assays were performed at a SPION concentration of 23.5 μg/ml, which was determined as being within the range investigated by Kirakli et al. [56 (link)].
NPs used for this study were SPIONs with a 5 nm diameter, acquired from Sigma, US (product number 725331), suspended in H2O at a concentration of 5 mg/ml, with the molecular weight of Fe3O4 being 231.53 g/mol. For the purpose of this study, all assays were performed at a SPION concentration of 23.5 μg/ml, which was determined as being within the range investigated by Kirakli et al. [56 (link)].
3
Prussian Blue Staining for SPION Uptake in ADSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Loading of SPIONs into ADSCs and the labeling efficiency were confirmed by Prussian blue staining. Briefly, passage three ADSCs were seeded in 6-well plates and cultured with ADSC medium containing SPIONs (Sigma-Aldrich, St. Louis, MO, USA) at various concentrations (0, 1, 10, 20, 50, and 100 μg Fe ml−1) for 24 h. After incubation, the medium was removed, and the cells were washed 3 times with PBS. Following fixation for 10 min in 4% paraformaldehyde at room temperature, the cells were incubated in a Prussian blue staining solution (1:1 mixture of 1 mol l−1 hydrochloric acid and potassium ferrocyanide [Sigma-Aldrich, St. Louis, MO, USA]) for 30 min.
4
SPION-Mediated miRNA Delivery for Cell Studies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SPIONs were purchased from Novobio (Novobio Biotechnology Co., Ltd, Shanghai, China). According to the manufacturer's instructions and previously published methods, 5 μl of 0.2 mM SPIONs was thoroughly mixed with 5 μl of 10 μM miR‐141 oligonucleotide RNA(UAACACUGUCUGGUAAAGAUGG) (Sigma‐Aldrich, St. Louis, USA) or miR‐Mut(UcACtCaGcCUcGUgAucAUuG), vortexed for 10 s and then maintained at room temperature for 20 min. A total of 10 μl of the SPION‐miR mixture was then combined with 90 μl of DMEM:F12 (1:1) serum‐free medium, added to 1 × 104 cells/ml and incubated for 72 hr at 37°C in 5% CO2.
5
Size-Dependent Aggregation of SPIONs
6
SPION Labeling of Passage 3 ADSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As described previously1 (link), passage 3 ADSCs were seeded in culture plates and cultured with the complete medium containing SPIONs (Sigma-Aldrich, St. Louis, MO, USA) at a final concentration of 50 µg Fe/mL for 24 h. After incubation, the medium was removed, and the cells were washed three times with PBS for use in further experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!