M6a rna methylation quantification kit
The M6A RNA methylation quantification kit is a laboratory tool designed to measure the level of N6-methyladenosine (m6A) modification in RNA samples. The kit provides a convenient and efficient method for quantifying m6A levels, which is a prevalent epigenetic modification involved in various biological processes.
Lab products found in correlation
38 protocols using m6a rna methylation quantification kit
m6A Quantification and Immunoprecipitation
m6A RNA Methylation Quantification in Cultured Cells
After reverse transcription, quantitative PCR assay was performed using SYBR Green (Applied Biosystems, Foster City, CA) method. The setting for amplification was 95°C/30 s, followed by 40 cycles of 95°C/30 s, 59°C/20 s, and 72°C/30 s. Primers were generated by Sangon Biotechnology (Shanghai, China). Primer sequences were:
IFNA, 5′‐ATTTCTGCTCTGACAACCTC‐3′, 5′‐CTGAATGACTTGGAAGCCTG‐3′
IFNB, 5′‐ACTGCAACCTTTCGAAGCCT‐3′, 5′‐AGCCTCCCATTCAATTGCCA‐3′
IFNG, 5′‐TGCAGGTCATTCAGATGTAGCGGA‐3, 5′‐TGTCTTCCTTGATGGTCTCCACACTC‐3′
ISG15, 5′‐TTTGCCAGTACAGGAGCTTG‐3′, 5′‐TTCAGCTCTGACACCGACAT‐3′
GAPDH, 5′‐TGGTATCGTGGAAGGACTCA‐3′, 5′‐CCAGTAGAGGCAGGGATGAT‐3′
Quantifying RNA Methylation Using m6A Kit
Quantifying Global RNA Methylation Levels
Shortly, the methylated fraction of total RNA, through ELISA-like reactions, was recognized by the m6A antibody and quantified in a microplate spectrophotometer by reading the absorbance at 450 nm.
In each experiment, the percentage of m6A was calculated using the second-order regression equation of a standard curve that was constructed by mixing equivalent molar concentrations at different ratios of full unmethylated and methylated control DNA. Each sample was analyzed in triplicate.
LPS-Induced m6A RNA Methylation Quantification
Total RNA was extracted, and total m6A content was determined using an m6A RNA methylation quantification kit (EpiGentek, Farmingdale, NY, USA) according to the manufacturer's instructions.
Quantifying m6A RNA Methylation
Quantification of m6A RNA Methylation
Quantifying m6A RNA Modification
Quantification of m6A Modifications in Pterygium
Quantification of m6A in RNA
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!