Mdv3100

Manufactured by Apexbio

Sourced in United States

The MDV3100 is a laboratory equipment designed for sample analysis. It provides precise measurement and data collection capabilities for researchers and scientists.

Automatically generated - may contain errors

Lab products found in correlation

3 isobutyl 1 methyl xanthine (ibmx), by Adipogen (3 mentions) Doxycycline, by Enzo Life Sciences (3 mentions) Gsk126, by Selleck Chemicals (3 mentions) Epz 6438, by Selleck Chemicals (2 mentions) R1881, by Apexbio (2 mentions) Arn 509, by Apexbio (2 mentions) Dextran coated charcoal stripped fbs, by Sartorius (2 mentions) Dznep, by Cayman Chemical (1 mentions) Sk br 3, by National Collection of Authenticated Cell Cultures (1 mentions) U87mg, by National Collection of Authenticated Cell Cultures (1 mentions) U251mg, by National Collection of Authenticated Cell Cultures (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Rpmi 1640, by Thermo Fisher Scientific (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Phenol red free dmem, by Thermo Fisher Scientific (1 mentions) Isoproterenol, by Merck Group (1 mentions) Dznep, by Apexbio (1 mentions) Control sirna, by GenePharma (1 mentions) Lipo2000 transfection reagent, by Thermo Fisher Scientific (1 mentions)

6 protocols using mdv3100

Pharmacological Modulation of Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The activators and inhibitors used in this study were obtained from the following sources: ISO (Sigma), Forskolin (FSK, LC Laborartoy), IBMX (Adipogen), ICI (Tocris), PKI (Tocris), PRO (Tci America), GSK126 (Selleck), DZNEP (Cayman Chemical), EPZ6438 (Selleck), TSP1 peptide (Athens Research and Technology), MDV3100 (Apexbio) and Doxycycline (Enzo), TSA (Cayman). The doses and duration of their treatments were as indicated.

Zhang Y., Zheng D., Zhou T., Song H., Hulsurkar M., Su N., Liu Y., Wang Z., Shao L., Ittmann M., Gleave M., Han H., Xu F., Liao W., Wang H, & Li W. (2018). Androgen deprivation promotes neuroendocrine differentiation and angiogenesis through CREB-EZH2-TSP1 pathway in prostate cancers. Nature Communications, 9, 4080.

+ Open protocol

+ Expand

Cell Culture and Hormone Treatment Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa, SKBR-3, U251MG, and U87MG cells were obtained from China Center for Type Culture Collection (CCTCC, Shanghai, China). Neuro2A, SH-SY5Y, and BIU-87 cells were kind gifts from Dr. Yuxian Shen (Anhui Medical University, Anhui, China); SW480 and SW620 cells were gifts from Dr. Siying Wang (Anhui Medical University); PC-3 and LNCaP cells were gifts from Dr. Xuemei Huang (Harbin Institute of Technology, Heilongjiang, China). The cells were cultured in DMEM or RPMI 1640 (Gibco, NY, USA) supplemented with 10% fetal bovine serum (Invitrogen), 100U/ml penicillin, and 100 mg/ml streptomycin in a humidified incubator with 5% CO₂ at 37°C. For treatment with R1881 or ARN-509 and MDV3100 (Enzalutamide, brand name Xtandi) both obtained from APExBio, TX, USA, cells were grown in phenol red-free DMEM (Gibco) medium supplemented with 10% (or indicated concentration, v/v) dextran-coated charcoal stripped FBS (Biological Industries, Israel) for 72 h prior to treatment. Every 24 h, the medium was replaced with medium with or without hormone and the cells were incubated for a further 24 to 72 h before analysis. Plasmids expressing wild-type SVIP has been previously described [18 ]. For transient transfection or RNA interference (RNAi), plasmid or siRNA was transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.

Bao D., Cheng C., Lan X., Xing R., Chen Z., Zhao H., Sun J., Wang Y., Niu C., Zhang B, & Fang S. (2017). Regulation of p53wt glioma cell proliferation by androgen receptor-mediated inhibition of small VCP/p97-interacting protein expression. Oncotarget, 8(14), 23142-23154.

+ Open protocol

+ Expand

Activator and Inhibitor Compound Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The activators and inhibitors used in this study were obtained from the following sources: Isoproterenol (ISO) (Sigma), Forskolin (FSK, LC Laborartoy), IBMX (Adipogen), ICI118,551 (ICI) (Tocris), propranolol (PROP) (Tci America), protein kinase A inhibitor peptide 14-22 (PKI) (Tocris), GSK126 (Selleck), EPZ-6438 (Selleck), DZNeP (Apexbio), MDV3100 (Apexbio) and Doxycycline (Enzo). The doses and duration of their treatments were as indicated. ISO, PROP, ICI, PKI and Doxycycline were dissolved in water, while all other chemicals were dissolved in DMSO.

Zheng D., Zhang Y., Yang S., Su N., Bakhoum M., Zhang G., Naderinezhad S., Mao Z., Wang Z., Zhou T, & Li W. (2024). Androgen deprivation induces neuroendocrine phenotypes in prostate cancer cells through CREB1/EZH2-mediated downregulation of REST. Cell Death Discovery, 10, 246.

+ Open protocol

+ Expand

Castrated BALB/C Mice Xenograft Model for Prostate Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Four weeks old male BALB/C nude mice, obtained, and maintained in specific pathogen free Animal Center of Dalian Medical University, were castrated. 1week after castration, mice were subcutaneously injected in the flank with 5 × 10⁶ U87MG cells mixed with 100 μl PBS. The tumor size was measured daily with a caliper beginning 1 week after inoculation, and the volume was calculated as π/6 × length × width². After the tumor volume had reached 100 mm³, the mouse was treated with MDV3100 (APExBio) or placebo (control) at a dose of 10 mg/kg body weight by daily oral gavage. MDV3100 stock were prepared in vehicle aqueous slurry (placebo), containing 20% PEG-400, 0.25% Tween-80, and 0.5% w/v carboxymethylcellulose (CMC) solution in 20 mM citrate buffer (pH 4.0), stored at 4°C. Xenograft tumors were excised upon sacrifice on day 14 post-drug treatment.

+ Open protocol

+ Expand

Cell Culture and Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

SH-SY5Y, N2a, HeLa, and RAW264.7 were cultured and maintained in Dubelcco's Modified Eagle Media (DMEM) (Gibcol) supplemented with 10% fetal bovine serum (FBS) and 1% Penicillin/Streptomycin (Hyclone). For treatment with vehicle (DMSO), R1881 or ARN-509 and MDV3100, both obtained from APExBio, TX, USA, cells were grown in phenol red-free DMEM (Gibco) medium supplemented with 10% (or indicated concentration, v/v) dextran-coated charcoal stripped FBS (Biological Industries, Israel) for 72 h prior to treatment. Cells were incubated at 37°C in a humidified incubator containing 5% CO₂. To inhibit AR expression, siRNAs targeting full length AR (siARa, 3′- AAGACGCUUCUACCAGCUCAC -5′; siARb, 3′- AAGAAGGCCAGUUGUAUGGAC -5′; siARc, 3′-GACCUACCGAGGAGCUUU-5′) or siRNA control ordered from GenePharma (Shanghai, China) were transfected using Lipo2000 transfection reagent (Invitrogen) in accordance with the manufacture's protocol.

Sun J., Wang D., Guo L., Fang S., Wang Y, & Xing R. (2017). Androgen Receptor Regulates the Growth of Neuroblastoma Cells in vitro and in vivo. Frontiers in Neuroscience, 11, 116.

+ Open protocol

+ Expand

Signaling Pathway Modulation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The activators and inhibitors used in this study were obtained from the following sources: Isoproterenol (ISO) (Sigma), Forskolin (FSK, LC Laborartoy), IBMX (Adipogen), ICI118,551 (ICI) (Tocris), propranolol (PRO) (Tci America), protein kinase A inhibitor peptide 14–22 (PKI) (Tocris), GSK126 (Selleck), MDV3100 (Apexbio) and Doxycycline (Enzo). The doses and duration of their treatments were as indicated.

Li W., Zheng D., Zhang Y., Yang S., Su N., Bakhoum M., Zhang G., Naderinezhad S., Mao Z., Wang Z, & Zhou T. (2023). Androgen deprivation induces neuroendocrine phenotypes in prostate cancer cells through CREB1/EZH2-mediated downregulation of REST. Research Square.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!