Cl 316 243

Two groups of five female WT C57BL/6 female mice (postnatal day 35) were given 3 daily ip injections with the adrenergic agonist CL 316,243 (Cayman Chemical; 1 mg/kg BW) in 0.1 ml vehicle or vehicle alone (controls). Samples (approximately 10 mg) of gonadal WAT were collected 24 h after the final treatment and frozen either with liquid nitrogen for subsequent PCR analysis or on dry ice for western blotting. iBAT, pBAT, pvBAT and ingBAT (5–10 mg each) were then harvested for western analysis. Additional iBAT and pBAT samples from control mice were used for PCR.

BALF obtained from N and IH rats were centrifuged at 500 g for 10 min (Kubota 1720, Tokyo, Japan). The pellet was resuspended in phenol red free RPMI 1640 medium (Gibco Laboratories, Grand Island, NY) with 1% streptomycin at 1.4 x 10⁵ cells / mL. The cells were plated at 4.2 x 10⁵ macrophages per well in polystyrene tissue culture plates and allowed to adhere for 12 h at 37°C in an atmosphere of 5% CO₂ / 95% O₂. Then, 100 μM of CL316243 (Tocris Bioscience), 100 μM of isoproterenol (LKT Laboratories, Minneapolis, MN), and 100 μM of CL316243 + 50 μM of L-NIL (Cayman Chemical) were administered. After incubation for 30 h at 37°C, the media were ultrafiltered at 7000 g x 20 min with ultracentrifugal filter units for 10 kD molecules (EMD Millipore, Billerica, MA). NO levels in the cell-free supernatant were determined by analysis of its relative stable metabolite nitrite using the Griess reaction with a fluorometric NO₂/NO₃ Assay Kit-FX (Dojindo Laboratories, Tokyo, Japan).

Cxcl5 KO mice were generated using CRISPR/Cas9 system with the sgRNA sequence 5′ CATCTCGCCATTCATGCGGATGG 3′ on C57BL/6N-Tac background mice by the Korea Mouse Phenotyping Center (KMPC). Cxcl5 KO mice were created by deleting a 16-bp sequence of exon 1 of the Cxcl5 gene. Mutation of the Cxcl5 gene was confirmed with WT allele- and mutant allele- specific primers (as listed in supplemental Table S1). All the phenotyping was performed by KMPC following the ARRIVE guidelines. For the cold exposure experiment, 8-week-old male mice were maintained at thermoneutral temperature (30°C) for 3 days before the 1 day (24 h)-long cold exposure (6°C) (28 (link)). An injection of CL 316,243 (Cayman) (1.0 mg/kg body weight) was administered intraperitoneally for 3 days at the same time each day. The body weight of each mouse was measured every week, and the body composition was measured in 21-week-old mice. All animal experiments and protocols were approved by Seoul National University Institutional Animal Care and Use Committee (IACUC) (SNU-160825-2-1).

Studies on mice were performed according to the permission from the Cornell University Institutional Animal Care and Use Committee. Four-week-old wild-type male C57BL/6J mice were purchased from Jackson Laboratory (#000664) and housed at room temperature (25 °C) with 12 h cycles of darkness and light. Mice were fed ad libitum food and water. To conduct pharmacologically induced thermogenesis experiments, 5-week-old mice were acclimated to a thermoneutral environment (30 °C) for 7 days. Subsequently, mice were daily intraperitoneally injected (IP) for 7 consecutive days with either saline or 1 mg/kg of CL 316,243 (Cayman Chemical #17499, Ann Arbor, MI, USA) (n = 4, per treatment). Following euthanasia with carbon dioxide, brown, inguinal, and white adipose depots, along with liver tissue, were collected. Each sample was immediately flash frozen in liquid nitrogen and stored at −80 °C for further protein or RNA extractions.

Reagents used in this study included isoproterenol (Sigma Aldrich), salbutamol, forskolin, bucladesine, (Wako), CL‐316243, H89, ICI‐118551, L‐755507 (Cayman Chemical), CGP20712A (R&D Systems), and recombinant human IL‐1β (Peprotech).