The largest database of trusted experimental protocols

Dharmafect duo transfection reagent

Manufactured by Horizon Discovery
Sourced in United States

DharmaFECT Duo is a transfection reagent designed to facilitate the delivery of small interfering RNA (siRNA) and plasmid DNA into a variety of cell types. It is a lipid-based formulation optimized for high transfection efficiency while maintaining low cellular toxicity.

Automatically generated - may contain errors

60 protocols using dharmafect duo transfection reagent

1

CRISPR-Cas9 Transfection in HEK293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells were seeded in 96-well plates at 20,000 cells per well. The following day, crRNAs and tracrRNA (GE Healthcare Dharmacon, #U-002000-50) were resuspended with 10 mM Tris-HCl pH 7.4 buffer (GE Healthcare Dharmacon, #B-006000-100) to 10 μM. For transfection in triplicate wells of duplicate cell plates, a deep-well plate was prepared with a 1:1 mixture of tracrRNA and each crRNA (5 μM each) diluted in MEM-RS medium (GE Healthcare HyClone, #SH30564.01) to 250 nM along with 1.4 μg of plasmid (70 μL total volume per well). DharmaFECT Duo transfection reagent (GE Healthcare Dharmacon, #T-2010-01) was diluted with MEM-RS medium (240 μL of DharmaFECT Duo transfection reagent was added to 3.76 mL of MEM-RS medium). Diluted transfection reagent (70 μL) was added to the crRNA:tracrRNA in the deep-well plates and incubated at room temperature for 20 minutes. After incubation, 560 μL of full growth medium was added per deepwell to obtain a complete transfection mixture (700 μL total) for triplicate transfection, in 2 plates. In each well, the medium on the plated cells was replaced with 100 μL of transfection mixture (final concentration: 0.6 μL of the DharmaFECT Duo transfection reagent, 200 ng of plasmid, and 25 nM of the crRNA:tracrRNA in each well). The cells were incubated at 37° C with 5% CO2 for 72 hours.
+ Open protocol
+ Expand
2

Dissecting miR-29a Regulatory Mechanisms

Check if the same lab product or an alternative is used in the 5 most similar protocols
For miR-29a promoter activity, upstream promoter region of miR-29a/b1 containing MYC binding sites was cloned into Luc2 Luciferase Expression vector (E6651, Promega). PCCs were co-transfected with control or siMYC, and MYC binding site Luc2 Luciferase vector using DharmaFECT Duo Transfection Reagent (T-2010–02, Dharmacon). For LOXL2 promoter activity, LOXL2 3’-UTR wild type (3’-UTR WT) and mutant (3’-UTR MUT) luciferase vectors consisting of miR-29a binding site were constructed respectively. The PCCs were co-transfected with control or miR-29a mimic, and 3’-UTR WT, or control or miR-29a mimic, and 3’-UTR MUT. 48 hrs post-transfection, luciferase activity was measured by Dual Glo® Luciferase Assay System (E2920, Promega) following manufacturer’s instructions. Firefly luciferase luminescence was normalized to Renilla luciferase activity for each transfected well.
+ Open protocol
+ Expand
3

Luciferase Assay for HDAC4 3'UTR Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
For luciferase reporter assays, MCF-7 cells were co-transfected with HDAC4 3′UTR luciferase vector (GeneCopoeia, Catalog # HmiT023167-MT05) and pre-miR-10b or miRNA negative control, using DharmaFECT Duo Transfection Reagent (Dharmacon). The vector has HDAC4 3′ UTR sequence inserted downstream of the secreted Gaussia luciferase (GLuc) reporter gene system, driven by SV40 promoter for expression in mammalian cells. A secreted Alkaline Phosphatase (SEAP) reporter, driven by a CMV promoter, is also cloned into the same vector (pEZX-MT05) and serves as the internal control. 48 h post- transfection, Gluc and SEAP luciferase activities were assayed using Secrete-PairDual Luminescence Assay Kit (GeneCopoeia), following exactly the same procedure as described in the vendor’s protocol.
+ Open protocol
+ Expand
4

Transfection and Suspension Culture Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were transfected with the indicated siRNA and DNA plasmid using Dharmafect Duo transfection reagent (Dharmacon). After 48 hours, cells were washed, trypsinized, and added to each well of either normal or polyHEMA-coated 6-well tissue culture plates. The cells were incubated 6 hours, then collected for analysis via Western blotting.
+ Open protocol
+ Expand
5

Evaluating miR-132 binding to 3'UTRs

Check if the same lab product or an alternative is used in the 5 most similar protocols
GAT1, PTEN and MeCP2 3´UTR fragments were amplified from genomic DNA using a Q5 High-Fidelity Taq Polymerase, digested with NheI and NotI and cloned in the pmirGLO Dual-Luciferase reporter vector (Promega GmbH, Mannheim, Germany)). All plasmids were sequenced before use. The following primers were used for cloning of GAT1, PTEN and MeCP2 fragments containing a predicted miR-132 binding site: GAT1_fwd: atattagctagccgaccaccacttgatgtctg and GAT1_rev: atattagcggccgcaaaatgcccttttcctgtg; PTEN_fwd: atattagctagctgtgtaatcaaggccagtgc and PTEN_rev: atattagcggccgctcttttttttgtgtgcag; MeCP2_fwd: atattagctagcaaatcgacgcccgagttag and MeCP2_rev: atattagcggccgcgaaaattcctttcacccacca. Plasmids were co-transfected with the miR-132 mimic or a negative control (C.elegans miR-67 mimic) into Hela cells using DharmaFECT Duo transfection reagent (GE Healthcare Dharmacon Inc., Lafayette, CO, USA) according to the manufacturer’s protocol. Firefly luciferase activity was assessed as previously described27 (link) using the Renilla-Glo Luciferase System (Promega) according to the manufacturer’s protocol.
+ Open protocol
+ Expand
6

Ndrg1 Knockdown in 3T3-L1 Adipocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fully differentiated 3t3l1 cells were transfected using Dharmafect Duo transfection reagent with siRNA against Ndrg1 or NonTarget control (Dharmacon) according to the manufacturer’s protocol. Cells were used for experiments 48 hours post transfection.
+ Open protocol
+ Expand
7

Silencing miR-140 in RL-65 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
RL-65 cells were seeded at 3 × 105 cells per well in 6-well plates and transfected with anti-miR-140 or a control anti-miRNA at a final concentration of 200 nM (Thermo Fisher Scientific, Waltham, MA) using DharmaFECT® Duo transfection reagent (Dharmacon, Lafayette, CO). After 3 days of transfection, cells were split and transfected repeatedly with anti-miR-140 or control every 3–4 days for a total of four times. Experiments were performed in triplicate and representative results from three independent repeats are presented.
+ Open protocol
+ Expand
8

Dual-Luciferase Assay for miR-103a Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 cells were transfected with 0.4 μg of the PTEN reporter plasmid containing the predicted miR-103a-binding sites (Addgene, plasmid 21326) or mutated miR-103a-binding sites/Renilla luciferase plasmid (Promega, Madison, WI) (10:1), together with control mimics or miR-103a mimics, using a DharmaFECT duo transfection reagent (Dharmacon) in accordance with the manufacturer’s protocol. The cells were washed, and luciferase activity was determined by a Dual-Luciferase Reporter Assay System (Promega). Relative luciferase activity was first normalized by Renilla luciferase activity and then compared with those of the respective controls.
+ Open protocol
+ Expand
9

Optimized Cell Transfection Experiments

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the cell transfection experiments, siRNA and miR‐30a‐3p mimics were designed and synthesized by Sangon (Shanghai, China). DharmaFECT Duo Transfection Reagent was purchased from Dharmacon (NY, USA). Cells were seeded in 96‐well plates at a concentration of 1 × 106 cells per well and transfected with siRNA and miR‐30a‐3p mimics in RPMI‐1640 (Gibco, USA) according to the manufacturer's protocol. After 24 hours, transfected cells were collected and used in further experiments.
+ Open protocol
+ Expand
10

Quantifying miRNA-mRNA Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols
Synthetic oligonucleotides of human PPARα or SIRT1 mRNA 3′UTR was cloned into a luciferase reporter vector system (SwitchGear). HEK 293T cells were co-transfected with 100ng of PPARα or SIRT1 3′-UTR reporter and 0.1nmol of miR mimics (Exiqon) or 100ng of pre-miR plasmids using DharmaFECT Duo transfection reagent (Dharmacon) according to the manufacturer’s protocol. After 48 h, luciferase activity was measured. A reduced firefly luciferase expression indicates the direct binding of miRs to the cloned target sequence.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!