Quickchange 2 kit

Neurod5kb:jip3-mCherry was previously described (Drerup and Nechiporuk, 2013 (link)). Neurod5kb:mCherry plasmid was generated by recombining the neurod5kb promoter (Mo and Nicolson, 2011 (link)) p5e entry vector into the pDEST394 vector in the Gateway system by previously described methods (Kwan et al., 2007 (link)). Human RET9-mCherry and RET51-mCherry constructs in the EGFP-N1 vector were obtained from the Mulligan lab (Crupi et al., 2015 (link)) and digested with HindIII, NotI, and SphI to release the whole tagged construct and digest the EGFP-N1 vector backbone. Released RET fusion construct cassettes were ligated into HindIII/NotI-digested Gateway pME-MCS vector and subsequently recombined with the neurod5kb or cmv/sp6 promoter p5e entry vectors to yield neurod5kb:RET9/51-mCherry or cmv/sp6:RET9/51-mCherry in the pDEST394 destination vector (Kwan et al., 2007 (link)). Jip3 deletion constructs Δp150 and ΔJNK were derived from pME-Jip3 (Drerup and Nechiporuk, 2013 (link)) using the Quickchange II kit (Agilent) (primers in Table 1). mRNA was synthesized from Jip3 constructs or cmv/sp6:RET9/51-mCherry using SP6 mMessage Machine (Life Technologies) and microinjected at 500 pg/embryo for Jip3 constructs and 50 pg/embryo for RET9/51-mCherry constructs.

For yeast assays, the CDS of GRF6 was PCR amplified and cloned into the pEasy vector. Point mutations were generated using the QuickChange II kit (Agilent). The GRF6 fragments were then transferred to the modified pRS415 vector (pRS415 with the yeast ADH1 promoter sequence) to generate pRS415-pADH1:GRF6, pRS415-pADH1:GRF6^K56Q (carrying a K56Q mutation), pRS415-ADH1:GRF6^K56R (carrying a K56R mutation), pRS415-ADH1:GRF6^K75Q (carrying a K75Q mutation), pRS415-ADH1:GRF6^K75R (carrying a K75R mutation), pRS415-ADH1:GRF6^K56K75Q (carrying K56Q and K75Q double mutations), pRS415-ADH1:GRF6^K56K75R (carrying K56R and K75R double mutations). The cDNA of AHA2 was amplified by PCR and cloned into the vector pRS416 to create pRS416-pAHD1:AHA2. The wild-type or mutant GRF6 vectors were co-transformed with pRS416-pAHD1:AHA2 into the modified S. cerevisiae strain RS-72-v (MATa ade1–100 his4–519 leu2–3312, ura3) (Fuglsang et al. 2007 (link)), where the promoter of BMH2 and PMA1 replaced by pGAL1, and BMH1 and URA3 genes knocked out in the RS-72 strain. SC/−Lue, SC/−Ura and SC/−Lue/−Ura media supplemented with glucose or galactose were used to examine the effects of GRF6 acetylation on AHA2 activity. Each experiment was independently replicated more than three times, and each replicate contained yeast cells from three independent transformation events.

Human NLRP3 were cloned in pENTR1A (Invitrogen) from Flag-NLRP3 encoding plasmids kindly shared by F. Martinon (University of Lausanne, Lausanne, Switzerland). Mutations were performed using QuickChange II kit (Agilent Technologies). cDNAs were transferred in pInducer21 using recombination Gateway LR clonase Enzyme mix kit (Thermo Fisher Scientific) (Meerbrey et al., 2011 (link)). pMD2.G and pCMVR8.74 were gifts from D. Trono (plasmid #12259 and #22036; Addgene).

WT AADC and P330L variant were obtained as previously described [20 (link)]. Mutagenesis reaction was performed using the Quick-Change II kit (Agilent technologies) using the oligonucleotide CCTTTAGACTGGACCTCACTTACCTGAAGC and its complement. All mutations were confirmed by DNA sequence analysis of the whole ORF.
WT AADC and P330L variant were expressed and purified as described in [20 (link)]. The enzyme concentration was determined using an ε_M of 1.42·10⁵ M⁻¹ cm⁻¹ at 280 nm. PLP content was determined by releasing the coenzyme in 0.1 M NaOH using ε_M of 6600 M⁻¹ cm⁻¹ at 388 nm [27 (link)].

Luciferase reporter genes containing IER5-associated enhancers were assembled in pGL3-TATA (Wang et al., 2014 (link)). Mutatagenesis was with the QuickChange II kit (Agilent Technologies). Luciferase assays were performed using Dual Luciferase Assay Kit (Promega) as described (Malecki et al., 2006 (link)) using lysates from cultured cells that were co-transfected with firefly luciferase and internal control Renilla luciferase plasmids using Lipofactamine 2000 (Thermo Fisher Scientific).