The largest database of trusted experimental protocols

Membrane protein extraction kit

Manufactured by Thermo Fisher Scientific
Sourced in United States

The Membrane Protein Extraction Kit is a laboratory tool designed to isolate and extract membrane-bound proteins from biological samples. The kit provides a standardized procedure to effectively separate membrane proteins from other cellular components, enabling their subsequent analysis and characterization.

Automatically generated - may contain errors

44 protocols using membrane protein extraction kit

1

Cellular Fractionation for Organelle Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cytoplasmic and membrane (including plasma membrane and organelle membrane) fractions were prepared using a membrane protein extraction kit (Thermo Fisher Scientific), and Golgi fraction was isolated using a Golgi isolation kit (Sigma-Aldrich).
+ Open protocol
+ Expand
2

Quantifying Cd39 mRNA and Protein in LPS-Treated BMDCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cd39 mRNA expression was detected in both LPS-treated and untreated BMDCs. Collected BMDCs were seeded in six-well plates and treated with LPS at 50 ng/ml for 48 h or left untreated, and then the cells were collected for qPCR and western blotting assays. For the qPCR assay, total RNA was extracted from cells and reverse transcribed into cDNA. cDNA (1.0 μg) was subjected to SYBR Green qPCR for Entpd1 on an iQ5TM (Bio-Rad), and Gapdh was used as a reference gene. The primers used were as follows: Cd39 (NM_009848.4) forward, 5′-TTATGGGCAAGATCAAAGACAG−3′ and reverse, 5′- GCAGGGAGAAGAGAACCATG−3′; and Gapdh (NM_001289726.1) forward, 5′- TGCTGAGTATGTCGTGGAG−3′ and reverse, 5′- TGTCATATTTCTCGTGGTTC−3′. The relative Cd39 transcript level was calculated with the 2−ΔΔCT method. To evaluate membrane-localized CD39 by western blotting, protein from the cell membrane was isolated with a membrane protein extraction kit (ThermoFisher Scientific) according to the manufacturer's protocol. An aliquot of the isolated membrane protein was subjected to western blotting for CD39 (#ab108248, Abcam) with Na+/K+ ATPase used as a reference (#58475, Abcam).
+ Open protocol
+ Expand
3

GRP78 Interactions in Membrane Proteomics

Check if the same lab product or an alternative is used in the 5 most similar protocols
Membrane protein lysates from DC2.4 cells were extracted using a Membrane Protein Extraction kit (89842; Thermo Scientific). The cDNA encoding mouse GRP78 and fragments of GRP78 were cloned into the pGEX-4T3 vector. Recombinant fusion proteins of GST-GRP78, GST fragments of GRP78, and GST control (20 µg) were incubated with 500 µL DC2.4 cell membrane protein lysates (1 × 106 cells) for 1 h on ice, followed by the addition of 50 µL glutathione agarose beads (16105; Thermo Scientific) for incubation overnight at 4°C with constant mixing. Protein complexes were washed extensively with buffers. The precipitates were analyzed by 10% SDS-PAGE and blotted using antibody specific for GST, GRP78, TLR4, and CD14.
+ Open protocol
+ Expand
4

Protein Extraction and Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total cellular proteins were extracted using 1× cell lysis buffer (Cell Signaling Technology). Membrane proteins were isolated using a membrane protein extraction kit (Thermo Fisher Scientific, Waltham, MA, USA). Protein concentrations were determined using the Bradford protein assay according to the manufacturer’s instructions (Bio-Rad, Hercules, CA, USA). Proteins were separated by 4–12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to nitrocellulose membranes. The membranes were blocked with 5% skim milk blocking buffer for 1 h, followed by overnight incubation at 4 °C with primary antibodies in blocking buffer. The membranes were washed in washing buffer three times, followed by incubation with secondary antibodies for 1 h. After successive washes, the membranes were developed using a SuperSignal West Pico Chemiluminescent kit (Thermo Fisher Scientific).
+ Open protocol
+ Expand
5

Protein Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
For total protein collection, cells were harvested and lysed using RIPA buffer (50 mM Tris–HCl, pH 8.0; 150 mM NaCl; 5 mM EDTA; 0.1% SDS; and 1% NP-40) supplemented with protease inhibitor cocktail26 (link). For secreted Samd1 collection, the culture medium containing the Samd1 was filtered through a 0.2 μm membrane and then concentrated by protein concentrator (Thermo, 10 K, 88527). Membrane protein extraction was performed with Membrane Protein Extraction Kit (Thermo, 89842) according to manufacturer’s instructions.
The protein concentration was determined by the Bradford assay, and equal amounts of protein in the lysates were boiled and fractionated by 7–12% SDS-PAGE. Primary antibodies against the following proteins were used: ApoB, β-actin, LaminA, Cadherin (Proteintech), Samd1 (Abcam). Signal was detected using Western ECL Substrate (Bio-Rad). To measure signals from the same gel, some full-length original blots might not be able to obtained.
+ Open protocol
+ Expand
6

Western Blot Analysis of ENaC Subunits

Check if the same lab product or an alternative is used in the 5 most similar protocols
Proteins were obtained with a membrane protein extraction kit (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's instructions and stored at −80°C before analysis. Proteins were quantified with a BCA kit (Beyotime, Shanghai, China). Equivalent amounts of sample were loaded and separated on 10% SDS‐PAGE gels, and electrotransferred onto polyvinylidene fluoride membranes (EMD Millipore, Billerica, MA). Membranes were blocked in Tris‐buffered saline with 5% nonfat milk for 2 h at room temperature, and then incubated with the anti‐α‐ENaC, anti‐β‐ENaC, or anti‐γ‐ENaC (1:150, Santa Cruz Biotechnology, Dallas, TX) and anti‐β‐actin antibodies (1:1000, Santa Cruz Biotechnology) overnight at 4°C. Membranes were then incubated with an IgG alkaline horseradish peroxidase‐labeled secondary antibody (1:10000, Zhongshan Golden Bridge, Beijing, China) at 37°C for 1 h. An enhanced chemiluminescence kit (EMD Millipore) and ChemiDoc XRS gel imaging system were used for image analysis. The relative abundance of proteins was quantified by Image Lab Software after normalization to β‐actin levels in the same sample.
+ Open protocol
+ Expand
7

Membrane Protein Extraction from Mouse Brain

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mice brain membrane fractions were extracted using a Membrane Protein Extraction Kit (89842, Thermo Fisher) according to the manufacturer's instructions. Briefly, 40 mg tissue was homogenize in 2 mL permeabilization buffer with protease inhibitor mixture, incubating at 4 °C for 10 min under gentle agitation. The lysates were centrifuged at 16,000× g for 15 min at 4 °C and the pellets were suspended in 1 mL of solubilization buffer with protease inhibitor mixture. After incubation for 30 min at 4 °C with constant mixing, and then centrifugation at 16,000× g for 15 min, the supernatant containing solubilized membrane was collected for Western blot analysis.
+ Open protocol
+ Expand
8

Membrane Protein Extraction for LC-MS/MS

Check if the same lab product or an alternative is used in the 5 most similar protocols
The transfected cells were grown to 80% confluence in 12-well plates. The experiment was divided into three parts: (1) Cells were incubated with CAP (25 μM) alone, or in combination with SB-705498 (0.1 μM), or in combination with RR (10 μM), or in combination with NOVO (1, 5, and 10 μM), for 5, 15, 30, and 60 min; (2) Cells were incubated with CAP (25 μM) for 5, 15, 30, and 60 min at the beginning. SB-705498, RR or NOVO was then added to the medium for another 15, 30, and 60 min. (3) After pretreatment with SB-705498, RR or NOVO for 24 h, cells were incubated with CAP (25 μM) in culture medium at 37°C in 5% CO2 for 5, 15, 30, and 60 min, respectively. After incubation, the medium was removed, and cell layers were washed three times with ice-cold PBS and then extracted with Membrane Protein Extraction Kit (Thermo Fisher Scientific Inc, Rockford, IL, United States), according to the manufacturer’s protocol. The cytosolic protein extracts were stored at -80°C until LC-MS/MS analysis.
+ Open protocol
+ Expand
9

Quantitative Mass Spectrometry of Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bovine serum albumin (BSA), iodoacetamide (IAA), dithiothreitol (DTT), membrane protein extraction kit and trypsin were purchased from Thermo Fisher Scientific (Rockford, IL). The synthetic light peptide and isotope-labeled heavy peptides were purchased from New England Peptides (Boston, MA) and Thermo Fisher Scientific (Rockford, IL), respectively. Ammonium bicarbonate buffer (98% purity) was procured from Acros Organics (Geel, Belgium). Chloroform, methanol, formic acid, and MS-grade acetonitrile were purchased from Fisher Scientific (Rockford, IL). Human serum albumin was purchased from Calbiochem (Billerica, MA). All other chemicals and reagents, unless indicated otherwise, were purchased from Sigma-Aldrich (St. Louis, MO).
+ Open protocol
+ Expand
10

Extraction of Aedes aegypti Gut Membrane Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Female Ae. aegypti were fed a blood meal and 72 h later, after the blood was digested, guts were dissected out in a drop of saline and transferred into an Eppendorf tube containing 100 mM PBS pH 7.2 (1.0 mL) and 100 μL of Protease inhibitor cocktail (Thermo Fisher Corporation, Waltham, MA USA). The tube was centrifuged for 5 min at 5000 rpm using an Eppendorf desk centrifuge, the supernatant removed, and the pellet was thoroughly homogenized with a Teflon tip. The homogenate was recentrifuged at 5000 rpm, the supernatant removed, and the pellet extracted using a Membrane Protein Extraction Kit (Mem-PER Thermo Fisher, USA) following manufacturer instructions. After extraction, the solubilized membrane proteins were centrifuged at 15,000 rpm for 3 min and the supernatant dialyzed against 0.1 M PBS pH 7.2 (100 mL) containing 0.5% CHAPS for 3 h at 4 °C in a dialysis bag with Mr cutoff of 3.5 kDa. The dialysis buffer was replaced, and the dialysis was repeated one more time. After dialysis, 50 μL of protease inhibitor cocktail was added to the extracted membrane protein (0.75 mL, 3.5 mg) and the extract stored at −80 °C.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!