The largest database of trusted experimental protocols

Centro lb960 96 well luminometer

Manufactured by Berthold Technologies
Sourced in United States

The Centro LB960 96-well luminometer is a laboratory instrument designed to measure luminescence in 96-well microplates. It is capable of detecting low-level light signals generated by various luminescent reactions, such as those used in bioluminescence assays, enzyme-linked immunosorbent assays (ELISAs), and cell-based reporter gene assays.

Automatically generated - may contain errors

7 protocols using centro lb960 96 well luminometer

1

Regulation of FGF4 by Sox2 and COP1

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 cells were seeded in 24-well plates at a density of 1 × 105. After 24 h, the cells were transfected using Lipofectamine 2000 (Invitrogen). The promoter region of FGF4 targeted by Sox2 was cloned into the pGL3-Luc vector (Promega, Madison, WI, USA), and subsequently co-transfected with Myc-Sox2 and Flag-OTUD7B or Flag-COP1, DET1 and CUL4A, together with the pRL-SV40 Renilla luciferase construct. Single overexpression of Sox2 was used as controls. Cell extracts were prepared 48 h after transfection and the luciferase activity was measured by using the Dual Luciferase System (Promega, Madison, WI, USA) and a Centro LB960 96-well luminometer (Berthold Technologies, Bad Wildbad, Germany).
The promoter region of FGF4 targeted by Sox2 is as below:
5′AGACCGTCTTTTAGAAAATAACAAGAAGAAAAGACATTTCAACTGTCTTCTCCCCAACACTCTTGGAGCCTAGGGCCTGGATTTAAAAAACACAAAATCTTATTGTCCTGTGAGCCACCAGACAGAAAGGAAGTTTGGGAGGAGCTCCCACCTCAGCTTTGGGGTGTGGCTTCTTCCATCTTGGGCTGTGGTACAGAATAGTATTTTAAGTATCCCATTAGCATCCAAACAAAGAGTTTTCTAAAGGAATGTGAAAGACAAAAAAAAAAAAATGCCAATGAGATTTTCCAGTCTTGCTGTCTGTAGCCTCCCATAAAGTTAATTCGGGAGGTTGCTCAGAAGTCTCCCAGCAGAGTCTTA-3′
+ Open protocol
+ Expand
2

Dual Luciferase Assay for Transcription Factor Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
CHO cells were cultured in Dulbecco's modified Eagle's medium with high glucose (Invitrogen), 10% standard fetal bovine serum (Hyclone), and 1% penicillin/streptomycin and maintained at 37°C with 5% CO2. For a 24-well plate, 0.5 µg of EO plasmid, 0.5 µg of MS plasmid, and 0.3 µg of pGL3 NSO plasmid were co-transfected per well using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Renilla luciferase plasmid (0.05 µg; pRL-TK from Promega) was co-transfected as an internal control. Firefly and Renilla luciferase activities were measured 24 h post transfection using the Dual Luciferase Kit (Promega) and a Centro LB960 96-well luminometer (Berthold Technologies). Alternatively, F9 embryonal carcinoma (EC) cells were used in the luciferase assay for motif characterization to understand the importance of variable positions in the Sox/Oct motif sequence. Cell culture, transfection, and sample preparation for F9 EC cells were performed as described earlier [31 (link)].
+ Open protocol
+ Expand
3

Transcriptional Regulation of Cytokine Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The promoter regions including the Zfp206-binding sites for IL2, IL12b and IL23a were cloned into pGL3-basic vector (Promega). A dual luciferase system (Promega, Madison, WI, USA) was used. For the luciferase assay in 293T cells, 4 × 105 cells were seeded into one well of a 24-well plate. After 18 h, 275 ng of luciferase reporter plasmid, 1 ng of plasmid pRL-SV40 and either 1 μg of NFATc2 overexpression vector or empty vector were co-transfected into the cells using Lipofectamine 2000 (Invitrogen). The pRL-SV40 plasmid served as an internal control for normalizing the transfection efficiency. After 40 h of transfection, the 293T cells were lysed, and the luciferase activity was determined with the dual luciferase system (Promega) using a Centro LB960 96-well luminometer (Berthold Technologies).
+ Open protocol
+ Expand
4

Luciferase Reporter Assay for TP63 and TRPS1

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the luciferase reporter assay, 293T cells were transfected with TP63-minimal CMV-Luc, mutant TP63-minimal CMV-Luc, flag-TRPS1, or truncated TRPS1 plasmids containing Renilla luciferase (pRL-SV40). The pRL-SV40 plasmid served as an internal control for normalizing the transfection efficiency. Firefly and Renilla luciferase activities were measured 48 h after transfection with the Dual-Luciferase System (Promega) using a CentroLB960 96-well luminometer (Berthold Technologies).
+ Open protocol
+ Expand
5

SNP-Mediated Transcriptional Regulation in SH-SY5Y Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human SH‐SY5Y neuroblastoma cells with endogenous Sox11 expression were seeded in 24‐well plates and transiently transfected with equimolar amounts of various pGL3‐promoter vectors (Promega) containing different inserted SNP‐site(s) by using LipofectamineTM 2000 (Invitrogen). pRLCMV (Promega) was co‐transfected as an internal control of transfection efficiency. The transfected cells were harvested after 48 hours. Luminescence was measured by the dual‐luciferase reporter assay system (Promega) using a Centro LB960 96‐well luminometer (Berthold Technologies).
+ Open protocol
+ Expand
6

C9ORF135 Promoter Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The C9ORF135 promoter was PCR-amplified from H1 hESC genomic DNA, digested with KpnI and HindIII, and then ligated into the pGL3-Basic reporter vector (Promega). The primers for C9ORF135 promoter amplification were as follows:
forward, 5′-GCAGGTACCAGAAGGGACTTGCGATTCTTG-3′; reverse, 5′-GCGAAGCTTAACCAGTGTTGCTTCCTGTCG-3′.
HEK293A cells were seeded on a 24-well plate and transiently transfected with the C9ORF135 promoter reporter vector and SOX2 or OCT4 expression plasmids with Lipofectamine 2000. pRL-CMV (Promega) expressing Renilla luciferase was transfected as an internal control. After 48 h, the transfected HEK293A cells were lysed in passive lysis buffer, and luciferase activity was measured with the dual-luciferase reporter assay system (Promega) with a Centro LB960 96-well luminometer (Berthold Technologies, Baden-Württemberg, Germany).
+ Open protocol
+ Expand
7

Survivin Promoter Regulation by SOX2 and OCT4

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Survivin promoters were amplified by PCR from human genome DNA, digested with XhoI and HindIII, and then ligated into the reporter vector pGL3-Basic (Promega, USA). The primers of Survivin promoter for PCR were forward, 5′AGCTCGGCGGGGTGGGAGGGGTGGGGAG3′, and reverse, 5′AGCTTAGTAGAGGCGGGGCGGCGCG3′. HEK 293 cells were seeded on a 24-well plate and transiently transfected with the Survivin promoter reporter vector and SOX2 or OCT4 expression plasmid using Lipofectamine 2000 (Invitrogen, USA). pRL-CMV (Promega, USA) expressing Renilla luciferase was transfected as an internal control. After 48 h, the transfected HEK293 cells were lysed in passive lysis buffer and luciferase activity was measured with the dual-luciferase reporter assay system (Promega, USA) using a Centro LB960 96-well luminometer (Berthold Technologies, Germany).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!