Fastking gdna dispelling rt supermix reverse transcriptase kit

Total RNA was isolated with the RNAprep Pure Cell Kit [DP430, TIANGEN Biotech (Beijing) Co. Ltd, Beijing, China]. Next, total RNA (2·5 µg) was reverse transcribed to obtain cDNA with the Fastking gDNA Dispelling RT SuperMix reverse transcriptase kit (KR170801: TIANGEN). Quantitative real‐time SYBR Green RT‐qPCR technology (TIANGEN) was used to determine expression levels of the selected target genes. Thermocycling conditions were 95 °C for 3 min, followed by 40 cycles at 95 °C for 5 s and 60 °C for 15 s. When the temperature rose from 65 °C to 95 °C, the signal was detected every 0·5 °C, and the melting curve was drawn. Primer sequences [Generay Biotech (Shanghai) Co., Ltd, Shanghai, China] used are as follows: OPN5 forward, 5′‐CTAGACGAAAGAAGAAGCTGAGACC‐3′, OPN5 reverse, 5′‐GCGGTGACAAAAGCAAGAGA‐3′; GAPDH forward, 5′‐GACATCCGCAAAGACCTG‐3′, GAPDH reverse, 5′‐GGAAGGTGGACAGCGAG‐3′; TRP1 forward, 5′‐AGGATAGCCTCCGGCATT‐3′; TRP1 reverse, 5′‐TTCCACCTCCACAAGACT‐3′; TRP2 forward, 5′‐AACTGCGAGCGGAAGAAACC‐3′, TRP2 reverse, 5′‐CGTAGTCGGGGTGTACTCTCT‐3′; MITF forward, 5′‐CGACGGGAGAAAGGGTGT‐3', MITF reverse, 5′‐CCTCGGAACTGGGACTGA‐3′; TYR forward, 5′‐TGCACAGAGACGACTCTTG‐3′, TYR reverse, 5′‐GAGCTGATGGTATGCTTTGCTAA‐3′.