Total RNA was extracted from cells using a total RNA extraction kit (Promega). Reverse transcription PCR was performed to synthesize cDNA via oligo(dT), and the mRNA levels of MARCH9, HSP47, STX3 and GCP60 were detected by quantitative real-time PCR, according to the instructions of the 2×EasyTay PCR SuperMix kit (TransGen Biotech).
Total rna extraction kit
Manufactured by Promega
Sourced in China, United States
The Total RNA Extraction Kit is a laboratory product designed to efficiently isolate and purify total RNA from various biological samples. It utilizes a standardized protocol to extract high-quality RNA suitable for downstream applications such as RT-PCR, Northern blotting, and RNA sequencing.
Automatically generated - may contain errors
Lab products found in correlation
M mlv reverse transcriptase, by Promega (4 mentions)
Rt master mix, by Takara Bio (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
T4 dna ligase, by Promega (3 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Sybr green fast mastermix, by Qiagen (3 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Top green qpcr supermix, by Transgene (2 mentions)
Cdna synthesis kit, by Takara Bio (2 mentions)
Pfu polymerase, by Promega (2 mentions)
Restriction endonuclease, by Promega (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Superreal premix plus, by Tiangen Biotech (2 mentions)
Tb green premix ex taq, by Takara Bio (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
First strand buffer, by Promega (2 mentions)
Dntp mix, by Promega (2 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Superscript 4, by Thermo Fisher Scientific (1 mentions)
Sybr green mix, by Takara Bio (1 mentions)
58 protocols using total rna extraction kit
1
Quantitative RT-PCR of Cell Genes
2
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In accordance with the manufacturer's instructions, the Total RNA Extraction Kit (Promega, LS1040) was used to extract total RNA, and RNA was reversely transcribed via the Super Script IV (Invitrogen, Catalog #18090010). Oligo(dT)12‐18 (Invitrogen, Catalog #18418012) was used to guide the reverse transcription. RT‐qPCR was carried out by using an Applied Biosystems 7500 Real‐Time PCR System and Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies). A fold change in relative transcription levels was determined by comparing them with endogenous Gapdh (internal control). Three replicates of RT‐qPCR experiments were carried out. Table S8 (Supporting Information) presents the primer sequences.
3
RNA Extraction and qPCR Analysis of Tight Junction Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction kit (Promega Biotechnology Co., Ltd., Beijing, China) was used to extract RNA from duodenum tissues of chickens. The total RNA was transcribed to obtain complementary DNA (cDNA ) samples. The primers used were synthesized by Takara Biotechnology Co., Ltd., Dalian, China. Primer design and synthesis were entrusted to Dalian Bao Biological Company, Dalian, China. The sequence is shown in Table 1 .Table 1
Real-time PCR primer sequences.
| Gene ID | Sequence | GC% | Tm | length(bp) |
|---|---|---|---|---|
| Occludin | CCTTGTTGGCCATGTGCAG | 57.9 | 63.7 | 78 |
| GGTCCACGGTGCAGTAGTGGTA | 59.1 | 64.4 | ||
| ZO-1 | TGGCAATCAACTTTGGGTAGCA | 45.5 | 64.8 | 156 |
| ATCCACAGAGGCAACTGAACCATA | 45.8 | 64.1 | ||
| Claudin-1 | CTCCCAAGCAGCTGCATATCTC | 54.5 | 63.5 | 148 |
| GCTCAGTCAGGCTAAGAACACCAA | 50 | 64.1 | ||
| β-actin | ATTGTCCACCGCAAATGCTTC | 47.6 | 64.4 | 113 |
| AAATAAAGCCATGCCAATCTCGTC | 41.7 | 64.5 |
Note: β-actin is an internal reference gene.
4
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were cultured in 24-well plates. 48 h post-transfection, the total cellular RNA was extracted using a Total RNA Extraction Kit (Promega, USA), according to the manufacturer’s protocol. The concentration of RNA was determined by measuring the absorbance at 260 nm, and 2 μg RNA was used for cDNA synthesis using an RT Master Mix (TaKaRa, Japan). qPCR amplification was performed using a mixture of Top Green qPCR Super Mix (Transgen, China), cDNA samples, and designated primers (Table 1 ). Relative gene expression was calculated by comparison of the CT value of the gene of interest with that of GAPDH, the internal control. http://dx.doi.org/10.17504/protocols.io.iaucaew [PROTOCOL DOI]
5
Transcriptional Analysis of X. campestris
Check if the same lab product or an alternative is used in the 5 most similar protocols
X. campestris pv. campestris was grown in NYG medium overnight at 28°C. Bacterial cells were collected, suspended to an optical density at 600 nm of 0.05 in the tested medium supplemented if necessary with small molecules of interest at their optimal dosages, and cultured for 16 or 20 h. Next, the total RNA was extracted from the culture with a total RNA extraction kit (Promega, Beijing, China), and reverse transcription was performed using a cDNA synthesis kit (TaKaRa, Dalian, China). Each kit was used according to the manufacturer’s instructions. To determine the transcription level of the genes tested, reverse transcription-quantitative PCR (qRT-PCR) was performed. SYBR green-labeled PCR fragments for the genes tested were amplified by using the corresponding primer sets listed in Table 3 . The expression level of the 16S rRNA gene was used as an internal control for data analysis. All of the qRT-PCRs were performed in triplicate.
+ Expand
6
Transcriptional Analysis of Xanthomonas campestris
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of Xcc strains was extracted with a total-RNA extraction kit (Promega, Madison, Wisconsin, USA) and reverse transcription was performed using a cDNA synthesis kit (Takara, Dalian, China), according to the manufacturer's instructions. To assay the transcription level of the genes studied, qRT-PCR and sqRT-PCR were performed using the total RNA extracted from Xcc strains. The synergy brand (SYBR) green-labeled PCR fragments were amplified using the primer sets listed in Supplementary Table S2 . The relative expression of genes was determined using the 2−ΔΔCt method (Livak and Schmittgen, 2001 (link)). The 16S rRNA gene was used as an internal standard. All sqRT-PCR and qRT-PCR tests were performed in triplicate.
Plasmids were introduced from E. coli strain into Xcc strain by triparental conjugation using pRK2073 (Supplementary TableS1 ) as the helper plasmid as described by Turner et al. (1985 (link)). Xcc transconjugants were selected in NYG medium supplemented with appropriate antibiotics.
Plasmids were introduced from E. coli strain into Xcc strain by triparental conjugation using pRK2073 (Supplementary Table
7
Comprehensive RNA Extraction and Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As instructed by the manufacturer, the Total RNA Extraction Kit (Promega Biotech, Beijing, China) was used for RNA extraction from the samples. The RNA concentration was measured using the NanoDrop ONE System (Thermo Scientific, Waltham, MA, USA). The PrimeScript RT Reagent Kit (Takara, Kyoto, Japan) was used for cDNA synthesis. The quantitative polymerase chain reaction was performed using SYBR Green Mix (Takara, Kyoto, Japan) on a real-time PCR system (Bio-Rad, Hercules, CA, USA) for 40 cycles (95 °C for 4 min, 95 °C for 30 s, optimal temperature of the primers for 30 s, and 65 °C for 30 s). The relative expression of the target genes was calculated using the 2−ΔΔCt algorithm. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the reference gene for all target genes. Table 1 depicts the sequences of PCR primers used in this study.
8
DNA Manipulation and Protein Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA manipulations followed the procedures described by Sambrook and associates50 . Plasmids were transformed into cells of E. coli and Xanthomonas spp. by electroporation or conjugation described by Turner and associates51 . The restriction endonucleases, T4 DNA ligase, and pfu polymerase were provided by Promega (Shanghai, China). The total RNAs from Xanthomonas spp. were extracted with a total-RNA extraction kit (Promega), and reverse transcription was performed using a cDNA synthesis kit (Fermentas Co., Vilnius, Lithuania). Each kit was used according to the manufacturer’s instructions.
Western blotting was carried out as previously described21 (link). Briefly, bacterial proteins were separated by 12% (w/v) SDS-PAGE and transferred onto PVDF (polyvinylidene difluoride) membrane (Millipore Corporation, Billerica, MA, USA). After blocking, the 1:2500 diluted anti-His-tag mouse monoclonal antibody (Qiagen, Shanghai, China) was used as the primary antibody, and the 1:2500 diluted horseradish peroxidase conjugated goat antimouse IgG (Bio-Rad, Hercules, CA, USA) was used as secondary antibody.
Western blotting was carried out as previously described21 (link). Briefly, bacterial proteins were separated by 12% (w/v) SDS-PAGE and transferred onto PVDF (polyvinylidene difluoride) membrane (Millipore Corporation, Billerica, MA, USA). After blocking, the 1:2500 diluted anti-His-tag mouse monoclonal antibody (Qiagen, Shanghai, China) was used as the primary antibody, and the 1:2500 diluted horseradish peroxidase conjugated goat antimouse IgG (Bio-Rad, Hercules, CA, USA) was used as secondary antibody.
9
Total RNA Extraction from Insect Midguts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the midguts of SSB larvae fed on artificial diets with or without SS amendment by use of Total RNA Extraction Kit (Promega Corporation) according to the manufacturer's protocol. Quantity of RNA was confirmed with Nanodrop (Bio‐Rad), and quality of RNA was monitored by electrophoresis gel analysis. Small aliquots of the isolated RNA were stored in −80°C for quantitative real‐time PCR (qRT‐PCR), and the remaining of RNA from the three replicates was used for RNA sequencing.
10
Liver miRNA Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from liver tissues and cells using a Total RNA Extraction kit (Promega Corporation) according to the manufacturer's protocol. The isolated RNA was then reverse transcribed into cDNA at 25°C for 10 min and then at 42°C for 60 min with dNTPs (10 mM) and 5X M-MLV buffer using the M-MLV RT kit (Promega Corporation) with either miRNA-specific stem-loop primers (Promega Corporation) or oligo dT primers (Sangon Biotech Co., Ltd.). Differential RT-qPCR was performed on an ABI 7500 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) using SYBR-Green master mix (Promega Corporation). The thermocycling conditions for qPCR were as follows: 95°C for 5 min; followed by 40 cycles at 95°C for 30 sec and 60°C for 1 min. The relative abundance of miRNA was normalized to the small nuclear RNA U6 and the expression levels of the genes were normalized to the endogenous reference gene β-actin. The relative amounts of the miRNAs and genes were measured using the 2-ΔΔCq method (21 (link)). RT-qPCR was conducted in triplicate and the primers used are shown in Table II .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!