Hot start dna polymerase

The bisulfite sequencing PCR (BSP) reaction system was composed of 1X PCR buffer (0.25 mM KCl), 6.25 μM of a dNTP mixture, 0.5 μM of the primers, 0.75 U of the hot start DNA polymerase (TaKaRa, Tokyo, Japan), and 20 ng of the modified DNA (bisulfite-converted as described above). First-roud PCR consisted of 35 cycles at an annealing temperature of 56°C, with the use of the primers MS1 (5′-GGAGTTGAATTTCGGAAGAT-3′) and MS2 (5′-TCCTCCATCAATTCCTCAACC-3′) (Figure 6A). With the use of the twentieth of the first-round PCR product as a template, second-round PCR consisted of 35 cycles at an annealing temperature of 60°C with the primers MS3 (5′-TTCGGGTGTAGGGGAGTTG-3′) and MS4 (5′-TCTCATTAAAAATAACCTCCTCC-3′) (Figure 6A). Under these conditions, we could assess the DNA methylation status of the DKK3 gene, which had a length of 342 bp and contained 43 CpG sites upstream of the transcription initiation site. The PCR products were analyzed on a 1.5% agarose gel. Each purified product was cloned into the pMD19-T Vector (TaKaRa) and transfected into DH5α competent cells (Vazyme Biotech Co., Piscataway, NJ, USA). Five to 10 clones from each sample were subjected to cycle sequencing (PE Applied Biosystems, Warrington, UK) and analyzed using the ABI 310 sequencer (Applied Biosystems, Foster City, CA, USA).

Total genomic DNA was extracted from fecal samples using QIAamp DNA stool mini kits (Qiagen, Germany), according to the manufacturer's instructions. We used seven tetra‐microsatellite loci to distinguish among individuals. These were as follows: GPL‐60, gpz‐20, GPL‐29, gpz‐6, GPL‐53, GPL‐44, and gpz‐47 (Huang et al., 2015). The probability of identity across these loci in the target population was estimated using GIMLET 1.3.3 (Valière, 2002). PCR amplifications were carried out in 25 μl reaction mixtures comprising approximately 50 ng of template DNA, 2 mm MgCl₂, 200 μmol of dNTP each, 15 pmol of each primer, 1.0 μg of bovine serum albumin (BSA), and 0.3 units of Hotstart DNA polymerase (Takara). Amplifications were performed using the following PCR procedure: an initial denaturation step for 5 min at 95°C, followed by 35 cycles of 95°C for 45 s, 30 s at locus‐specific annealing temperature and 50 s at 72°C，and a final elongation for 10 min at 72°C. For genotyping, the PCR amplification products were separated by capillary electrophoresis using a denaturing acrylamide gel matrix on an ABI 3730xl Genetic Analyzer. Alleles were detected using Genemapper 3.2 software.

For RNA interference in ESCs, short hairpin (shRNA) constructs for HIF2α were designed to target 21 base-pair gene specific regions and were then amplified into the pLKO.1-TRC (AgeI and EcoRI sites). The targeted sequences are as follows: HIF2α sh#1:GCTTCCTTCGGACACATAAGC; HIF2α sh#2: GGGACTTACTCAGGTAGAACT. pLKO.1-TRC-based lentiviral vectors were transfected into 293 T cells in combination with pMD2.G and psPAX2 plasmids. Virus-containing supernatant was collected after 48 hours and filtered through 0.45 μm filters (Millipore). ESCs were incubated in the virus supernatant for 48 hours. For gene overexpression, the coding region of HIF2α was cloned from mouse cDNA with Hot Start DNA Polymerase (Takara) and was inserted into the BglП and SalI sites of the PiggyBac transposon vectors. ESCs were transfected with 2 μg PiggyBac inserted with targets plus a 2 μg transposon vector using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. The modified cells were screened by treatment with 2 μg/ml puromycin for about one week.