Orf clone in cloning vector

Manufactured by Sino Biological

Sourced in China

The ORF Clone in Cloning Vector is a laboratory tool used to study and analyze gene expression. It consists of a DNA fragment containing an open reading frame (ORF) inserted into a cloning vector, which is a circular DNA molecule used to replicate and propagate the ORF in host cells. This product provides a convenient and standardized way to obtain purified ORF for further experimentation and analysis.

Automatically generated - may contain errors

Lab products found in correlation

5 alpha competent e coli cells, by New England Biolabs (1 mentions)

2 protocols using orf clone in cloning vector

ITGB6 Overexpression Vector Construction

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the construction of the ITGB6 overexpression vector, ITGB6 gene was amplified from ITGB6 cDNA ORF Clone in Cloning Vector (Sino Biological: MG50097-M) and cloned into the expression vector pLenti CMV GFP Blast (659-1) (Addgene plasmid # 17445)23 (link) in place of GFP. Cloning, lentiviral transduction, western blot and co-immunoprecipitation (Co-IP) were performed according to standard procedures as described in the supplementary methods.

Busenhart P., Montalban-Arques A., Katkeviciute E., Morsy Y., Van Passen C., Hering L., Atrott K., Lang S., Garzon J.F., Naschberger E., Hartmann A., Rogler G., Stürzl M., Spalinger M.R, & Scharl M. (2022). Inhibition of integrin αvβ6 sparks T-cell antitumor response and enhances immune checkpoint blockade therapy in colorectal cancer. Journal for Immunotherapy of Cancer, 10(2), e003465.

+ Open protocol

+ Expand

B7.1 Overexpression in EO771 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse B7-1 cDNA ORF Clone in Cloning Vector (SinoBiological, Beijing, China, Cat. #MG50446-G) was transfected into 5-alpha Competent E. coli cells (NEB, Ipswich, MA, USA, Cat. #C2987H), following manufacturer’s protocol. Colony PCR for B7.1 using the following primers: 5′ACGTACAGATCTATGGCTTGCAATTGTCAGTTGATG′3, 5′CATGCAGTCGACCTAAAGGAAGACGGTCTGTTCAGC′3 was performed to identify bacteria with the correct plasmid. All plasmids were verified by sequencing. B7.1 was ligated into the destination vector MSCV-IRES-Thy1.1 DEST (pMIT) (Addgene, Watertown, MA, USA, Cat. #17442). pMIT-B7.1 was transfected into Platinum E cells using Lipofectamine3000. Viral supernatant was collected and used to transduce EO771 cells. EO771-B7.1 expressing cells were selected for double positive Thy1.1/B7.1 expression by fluorescence-activated cell sorting (FACS) to avoid selecting for specific antigenic changes.

Camp F.A., Brunetti T.M., Williams M.M., Christenson J.L., Sreekanth V., Costello J.C., Hay Z.L., Kedl R.M., Richer J.K, & Slansky J.E. (2022). Antigens Expressed by Breast Cancer Cells Undergoing EMT Stimulate Cytotoxic CD8+ T Cell Immunity. Cancers, 14(18), 4397.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!