Unmodified, recombinant human histones H2A or H2A(K119C), H2B, H3, H3(K56Q), and H4 were expressed and purified as described [19 (link)]. Histones H3(K115ac, K122ac) and H4(K77ac, K79ac) were produced by expressed protein ligation as described [39 (link), 41 (link), 42 (link)]. The synthetic acetylations were confirmed by mass spectrometry analysis (Fig 1 ). Octamers were refolded at equimolar histone concentrations and purified by Superose 12 10/300 (GE Healthcare) size exclusion chromatography in 10 mM Tris-HCl pH 7.5, 2 M NaCl, 1 mM EDTA. Nucleosomes were reconstituted with Cy5 labelled 145 bp D02 DNA or 147 bp 601 DNA and histone octamer at a 1:1 molar ratio by double dialysis against 5 mM Tris-HCl pH 7.5, 0.5 mM EDTA, 1 mM benzamidine [43 (link)]. The products were separated by sucrose gradient velocity centrifugation [43 (link)]. Gradient fractions were analyzed by separation on a native polyacrylamide gel electrophoresis (PAGE) and imaged using a Typhoon 9410 variable mode fluorescent imager (GE Healthcare) or a Sapphire Biomolecular Imager (Azure Biosystems) (Fig 2 ). Fractions with fluorescent NPS DNA bound by histone octamer were combined. The sample buffer was exchanged to 5 mM Tris-HCl pH 7.5, 0.5 mM EDTA and nucleosomes were concentrated with Amicon Ultra centrifugal filters (EMD Millipore). Nucleosomes were stored at 4°C.
Typhoon 9410 variable mode fluorescent imager
Manufactured by GE Healthcare
The Typhoon 9410 is a variable mode fluorescent imager designed for high-quality detection and quantification of fluorescently labeled samples. The core function of the Typhoon 9410 is to capture and analyze fluorescent signals from a variety of sample types, including gels, blots, and microplates.
Automatically generated - may contain errors
4 protocols using typhoon 9410 variable mode fluorescent imager
1
Reconstitution and Purification of Recombinant Nucleosomes
2
PFV Integration Assay with Viral DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA oligomers were purchased from Integrated DNA Technologies. Preprocessed PFV viral donor DNA was KEY616 5′ ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3′ annealed to KEY675 5′ CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3′. Blunt PFV viral donor DNA was KEY616 annealed to KEY623 5′ CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACAAT 3′. Cy5 fluorophore labeling was at the 5′ end of KEY675 or KEY623.
PFV integration reactions were performed in 10mM HEPES, pH 7.5,110mMNaCl, 4 μMZnCl2, 5mMMgSO4, and 10mMDTT, 0.5 μM PFV IN, 1 μM viral donor DNA, 50 ng target DNA plasmid in a final volume of 15 μL. Where indicated 5mM MgCl2, 5mM MnCl2, or 5mMCaCl2 were substituted for MgSO4. Blunt viral donor DNA was used except when indicated. All reagents except target DNA were combined in 14 μL volume and incubated on ice for 15 min. Target DNA was added, reactions were incubated at 37 °C for 90 min, and stopped by the addition of 0.5% SDS, 1 mg/ml proteinase K. Reactions were incubated at 37 °C for an additional 60 min. Reaction products were separated by 1% agarose in TAE with 0.1 μg/mL ethidium bromide. Gels were scanned by Typhoon 9410 variable mode fluorescent imager (GE Healthcare) for ethidium bromide and Cy5. Images were analyzed by ImageQuant (GE Healthcare). Data was analyzed by paired t-test (GraphPad Prism).
PFV integration reactions were performed in 10mM HEPES, pH 7.5,110mMNaCl, 4 μMZnCl2, 5mMMgSO4, and 10mMDTT, 0.5 μM PFV IN, 1 μM viral donor DNA, 50 ng target DNA plasmid in a final volume of 15 μL. Where indicated 5mM MgCl2, 5mM MnCl2, or 5mMCaCl2 were substituted for MgSO4. Blunt viral donor DNA was used except when indicated. All reagents except target DNA were combined in 14 μL volume and incubated on ice for 15 min. Target DNA was added, reactions were incubated at 37 °C for 90 min, and stopped by the addition of 0.5% SDS, 1 mg/ml proteinase K. Reactions were incubated at 37 °C for an additional 60 min. Reaction products were separated by 1% agarose in TAE with 0.1 μg/mL ethidium bromide. Gels were scanned by Typhoon 9410 variable mode fluorescent imager (GE Healthcare) for ethidium bromide and Cy5. Images were analyzed by ImageQuant (GE Healthcare). Data was analyzed by paired t-test (GraphPad Prism).
3
PFV Integration Assay with Viral DNA
4
PFV Intasome-Catalyzed DNA Strand Transfer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PFV IN intasome catalysed strand transfer into supercoiled, nicked or linear pMP2 target DNA (50 ng) was examined over time at ambient temperature (21±1 °C). The 15-μl reactions included PFV intasome (20 nM) in Buffer A (10 mM Bis-Tris Propane-HCl (pH 7.45), 110 mM NaCl, 5 mM MgSO4, 4 μM ZnCl2 and 10 mM DTT). Following incubation, the reactions were stopped with the addition of 0.45% SDS and 900 μg ml−1 proteinase K. Products were separated on a 1% agarose gel, stained with ethidium bromide (0.1 μg ml−1), scanned using a Typhoon 9410 variable mode fluorescent imager (GE Healthcare Life Sciences) and analysed with ImageQuant TL software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!