The largest database of trusted experimental protocols

6 protocols using primescriptvr rt reagent kit

1

RNA Isolation and Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the HOEC or OSCC cell lines and tissues with RNAiso Plus (TaKaRa, Japan) or the mirVana Paris kit (Life Technologies, USA), according to the manufacturer’s guidelines. For mRNA quantification, the PrimeScriptVR RT reagent kit (TaKaRa, Japan) was utilized to reverse transcribe the RNA extracted with RNAiso Plus to cDNA. After that, the RNA was subjected to specific primer-based reverse transcription-quantitative PCR (RT-qPCR) using SYBR Premix Ex Taq (TaKaRa, Japan). For miRNA quantification, the total RNA extracted with the mirVana Paris kit was reverse transcribed and quantified with the All-in-One miRNA RT-qPCR detection kit (GeneCopoeia, China). After that, RT-qPCR was performed with the 7900HT Fast real-time PCR system (Thermo Fisher Scientific, USA). Subsequently, the threshold cycle (2−ΔΔCT) method was utilized to calculate relative expression of RNA, with GAPDH and U6 as the mRNA internal control and the miRNA internal control, respectively. Table 2 indicates the primer sequences used in this study.
+ Open protocol
+ Expand
2

Quantification of NF-κB, c-Rel, and ELK1 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. cDNA was synthesized for the detection of NF-κB1, c-Rel, and ELK1 expression using the PrimeScriptVR RT Reagent Kit (Takara, Dalian, China). A qRT-PCR assay was performed to evaluate the mRNA expression using the SYBR® Select Master Mix (Applied Biosystems Life Technologies, Beijing, China) on the ABI PRISM 7300 Sequence Detection System (Applied Biosystems Life Technologies). GAPDH mRNA was employed as an endogenous control and relative expression levels in each sample were measured by the 2−ΔΔCT method. The primers for the analysis of NF-κB1, c-Rel, ELK1, and TAB1 expression are shown in Supplementary Table 2. For qRT-PCR analysis of miR-134 levels, cDNA was synthesized from 10 ng of total RNA using TaqManTM miRNA hsa-miR-134 specific primers (Applied Biosystems Life Technologies) and a TaqManTM microRNA Reverse Transcription kit (Applied Biosystems Life Technologies). All reactions were performed in triplicate.
+ Open protocol
+ Expand
3

Quantification of miR-4458, LINC00665, and DOCK1 in AML

Check if the same lab product or an alternative is used in the 5 most similar protocols
All the RNAs were extracted from AML or normal bone marrow tissues and cells with the TRIzol reagent (Invitrogen, USA). After quantifying and assessing the RNAs with NanoDrop 2000 (Thermo Fisher Scientific, USA), the All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, China) was utilized to examine miR-4458 expression. As for the measurement of LINC00665 and DOCK1 mRNA expression, the PrimeScriptVR RT reagent Kit (Takara, Japan) was applied to reverse-transcribe PCR and generate cDNA. Then, the SYBR Premix Ex Taq (Takara, Japan) was used qRT-and subjected to qRT-PCR was conducted through ABI 7900 system (Thermo Fisher Scientific, USA). The relative expression of LINC00665 and DOCK1 were subsequently normalized by GAPDH, while that of miR-4458 was normalized by U6. The 2−ΔΔCT method was used to calculate their expression levels. The primer sequences are illustrated in Table 2.

The primer sequences for RT-qPCR.

GENEPrimer sequences (5′–3′)
miR-4458Forward: AGAGGTAGGTGTGGAAGAA
Reverse: GCGAGCACAGAATTAATACGAC
U6Forward: CTCGCTTCGGCAGCACA
Reverse: AACGCTTCACGAATTTGCGT
LINC00665Forward: GGTGCAAAGTGGGAAGTGTG
Reverse: CGGTGGACGGATGAGAAACG
DOCK1Forward: CCGCCGCAAACTTTTTCCTC
Reverse: AGATGTGCACAGTGTCTCCG
GAPDHForward: AGCCACATCGCTCAGACAC
Reverse: GCCCAATACGACCAAATCC
+ Open protocol
+ Expand
4

Quantitative RT-PCR Analysis of miRNA and mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells or the tissue samples using Trizol (Invitrogen), and cDNA was generated using the PrimeScriptVR RT reagent Kit (Takara, Dalian, China) or All-in-One miRNA qRT-PCR detection kit (GeneCopoeia, Guangzhou, China). A quantitative real-time polymerase chain reaction (qRT-PCR) assay was performed to evaluate mature miRNAs and mRNA expression using the SYBR Premix Ex Taq (TaKaRa). The relative expression levels of each sample were measured using the 2−ΔΔ CT method with β-actin and U6 snRNA serving as endogenous controls for qPCR of mRNA and miRNA, respectively. Amplifications were carried out according to the manufacturer's instructions in triplicate.
+ Open protocol
+ Expand
5

Bone Tissue RNA Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from bone tissues from spines using TRIzol reagent (Invitrogen, USA) and quantified using NanoDrop 2000 (Thermo Fisher Scientific, USA). Then 2 ug RNA was subjected to reverse transcription PCR to generate cDNA through the use of PrimeScriptVR RT reagent Kit (Takara, Japan), the qRT-PCR was then conducted to detect the expression of target genes using SYBR Premix Ex Taq (Takara, Japan). GAPDH was applied as the internal control, and the gene expression was calculated using 2 -ΔΔCT method. The measurement data were shown as mean ± standard deviation (SD), and the difference between two groups was analyzed by student's t-test using GraphPad Prism 8.0 (GraphPad Software, USA). Statistical significance was considered when P<0.05.
+ Open protocol
+ Expand
6

Quantifying mRNA Expression via RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from tumor cells and tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and 400ng of total RNA from each sample was converted to cDNA using the PrimeScriptVR RT Reagent Kit (Takara, Dalian, China). RT-qPCR was performed using SYBR Premix Ex Taq (Takara, Dalian, China) on the Stratagene Mx3000P Real-Time PCR System (Agilent Technologies, USA) according to the manufacturer's instructions. The primers for analysis are listed in Table 1. Gapdh mRNA served as an endogenous control, and relative levels of expression of other mRNAs were measured using the 2-ΔΔct method.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!