Viia 7 dx

Total RNA was isolated with the RNeasy Mini Kit (Cat. #: 74104; Qiagen, Valencia, CA, USA). 1 μg of RNA from each sample was reversely transcribed to cDNA using random hexamer primer with PrimeScript^™ RT Master Mix (Cat. #: RR036A; TaKaRa, Otsu, Shiga, Japan). Primers for each lncRNA were designed according to Primer 3 (http://sourceforge.net/projects/primer3/) online and checked with Basic Local Alignment Search Tool of NCBI to ensure unique amplification product. Real‐time PCR was performed on an Applied Biosystems ViiA^™ 7 Dx (Life Technologies, Carlsbad, CA, USA) using the SYBR green method according to the manufacturer's instructions. The PCR reaction conditions consisted of a denaturation step at 95°C for 30 sec., and then 40× PCR cycles at 95°C for 5 sec., 60°C for 34 sec. LncRNA and gene expression levels were quantified relative to the expression of GAPDH using an optimized comparative Ct (▵▵Ct) value method. All the primer sequences used were shown in Table S1. The 2^−∆∆Ct method was used to comparatively quantify the levels of mRNA.

To confirm the RNA-seq data, the expression profiles of randomly selected mRNAs and lncRNAs were tested in another 9 IH patients using quantitative real-time polymerase chain reactions (qRT-PCR) with the SYBR green method on an Applied Biosystems ViiA™ 7 Dx (Life Technologies, USA). Patient information is listed in Table 4. The sequences of the specific PCR primer sets used for qRT-PCR are listed in Table 5. The RNA expression levels were normalized to the internal control gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), using the 2^{(–△△Ct)} method as we previously described [39 (link)]. Three selected miRNAs were further examined by Bulge-Loop™ qRT-PCR according to the manufacturer’s protocol (RIBOBIO, Guangzhou, China) with the SYBR green method on an Applied Biosystems ViiATM 7 Dx (Life Technologies, USA). The miRNA expression levels were normalized to u6 (RIBOBIO, Guangzhou, China), using the 2^{(–△△Ct)} method.

Total RNA was extracted from murine skin tissues with TRIzol reagents (Invitrogen, USA). RNA was transcribed to cDNA using PrimeScript^TM RT reagent kit (Takara Bio Incorporation, Kusatsu, Japan) according to the instruction of the manufacturer. Quantitative PCR was then performed on ViiA 7 Dx (Applied Biosystems) using SYBR Premix Ex Taq^TM Π (Takara Bio Incorporation). GAPDH gene was used as an internal standard gene and the 2^-ΔΔCT method was utilized to quantitatively analyze the data. The primer sequences are shown below: IL-6 Forward: ACTTCCATCCAGTTGCCTTCTTGG, Reverse: TTAAGCCTCCGACTTGTGAAGTGG; IL-15 Forward: ACATCCATCTCGTGCTACTTGT, Reverse: GCCTCTGTTTTAGGGAGACCT; TNF-α Forward: ACGGCATGGATCTCAAAGAC, Reverse: GTGGGTGAGGAGCACGTAGT; IFN-γ Forward: CACGGCACAGTCATTGAAAG, Reverse: CATCCTTTTGCCAGTTCCTC; IL-17A Forward: GTCCAAACACTGAGGCCAAG, Reverse: ACGTGGAACGGTTGAGGTAG; GAPDH Forward: AGGTCGGTGTGAACGGATTTG, Reverse: TGTAGACCATGTAGTTGAGGTCA.