The largest database of trusted experimental protocols

Trucut v2 cas9 protein

Manufactured by Thermo Fisher Scientific

The Trucut V2 Cas9 protein is a laboratory tool designed for precision genome editing. It functions as a programmable nuclease that can be guided to target and cleave specific DNA sequences. The Trucut V2 Cas9 protein is a key component in CRISPR-Cas9 gene editing systems.

Automatically generated - may contain errors

2 protocols using trucut v2 cas9 protein

1

CRISPR-Mediated GM-CSF Gene Editing in Primary T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
sgRNA targeting the first exon of gene encoding GM-CSF was designed and synthesized according to the protocol described in the kit (Thermo Fisher). Primary T cells from a healthy donor (purchased from vendor PPA research) were activated with anti-CD3&CD28 dynabeads (Thermo Fisher) and then electroporated with RNP complex of the sgRNA candidates and Trucut V2 Cas9 protein (Thermo Fisher). Afterward, T cells were analyzed by intracellular staining of cytokines (LSR II, BD) to assess the efficiency of gene editing. The sgRNA targeted sequences before PAM motif are listed as:
1 GCTGCAGAGCCTGCTGCTCT; 2 GGAGCATGTGAATGCCATCC;
3 GCATGTGAATGCCATCCAGG; 4 GAGACGCCGGGCCTCCTGGA;
5 GATGGCATTCACATGCTCCC; 6 GCTCCCAGGGCTGCGTGCTG;
7 GCGTGCTGGGGCTGGGCGAG; 8 GCTGGGGCTGGGCGAGCGGG.
+ Open protocol
+ Expand
2

Engineered Anti-CD19/BCMA CAR-T with Cytokine Blockers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Peripheral blood was collected from the enrolled patient and processed with Ficoll (GE Healthcare) gradient centrifugation to isolate PBMC. T cells were purified from PBMC with the pan T isolation kit (Miltenyi). Purified T cells were activated with anti-CD3&CD28 dynabeads (Thermo Fisher) and transduced with 3rd generation lentivector encoding anti-CD19 or anti-BCMA CAR co-expressing IL6/IL1 blockers (scFv derived from Sirukumab and IL1RA), followed by electroporation with RNP complex of the sgRNA (targeting GM-CSF and TRBC) and Trucut V2 Cas9 protein (Thermo Fisher). T cells were further ex vivo expanded and analyzed for CAR expression and gene editing efficiency (Novocyte, Agilent). The CART cells were also tested for sterility and in vitro killing of leukemia cells Nalm6 (ATCC) expressing GFP or RPMI-8226 (ATCC) cells (Novocyte, Agilent).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!