Pspax2

The shRNA used to knock down CHRDL1 in gastric cancer cell lines was purchased from Shanghai GenePharma Co., Ltd. The shRNA sequences and negative control were synthesized as follows: CHRDL1 #sh1: ACGC CATGCACAGCATAATTT, #sh2 GTCCAAATGTTCA TTGCCTTT; BMP4 #sh1: TCCTTGAGGATAGACAGA, #sh2: GGGAGAAGCAGCCAAACTATG; NC: CCTAA GGTTAAGTCGCCCTCG. The shRNAs were packed into a lentivirus using pMD2G, pSPAX2 and shRNA2 according to the protocol provided by Clontech. The full-length human CHRDL1 cDNA was purchased from Addgene (Cambridge, MA, USA), subcloned into the pLVX-IRES-Puro vector, and packed into lentivirus with pMD2G and pSPAX2 to over express CHRDL1 in the target cells.

The FuGENE Transfection Reagent (Promega) was used for all transfections in accordance with manufacturer's instructions. For KDM6B knockdown, a KDM6B-specific shRNA was cloned into the pLVX-shRNA1 plasmid (Clontech). KDM6B-KD1: GTGGGAACTGAAATGGTATTT, KDM6B-KD2: GATGATCTCTATGCATCCA. For LDHA knockdown, LDHA-KD1: CAATCTGGATTCAGCCCG, LDHA-KD2: GCAAACTCCAAGCTGGTC. For a negative control, a scrambled sequence was used. Packaging was conducted with a three plasmid-system with psPAX2 and pMD2G (Clontech). The lentiviral supernatant was used to infect OS cell lines, stable cell lines were obtained after two weeks of screening with 2 μg/mL puromycin.

MCF-7 breast cancer cell strains and 293T cells were purchased from the Shanghai Cell Resource Center of the Chinese Academy of Sciences (Shanghai, China). The pSPAX2, pMD2G and pLVX-shRNA1 vectors were purchased from Clontech Laboratories (Mountain View, CA, USA). The Plasmid Midi kit was purchased from Qiagen (Valencia, CA, USA). Opi-MEM, Escherichia coli DH5α and Taq DNA polymerase were purchased from Invitrogen Life Technologies (Carlsbad, CA, USA). T4 DNA ligase, BamHI and EcoRI restriction enzymes were purchased from New England Biolabs (Ipswich, MA, USA). Liposome Lipfectamine 2000, Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS) and Trypsin were purchased from Invitrogen Life Technologies. The gel extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd. (Beijing, Japan). KOD high fidelity enzyme polymerase chain reaction (PCR) kit and Taq enzymes were purchased from Toyobo Co., Ltd. (Osaka, Japan). DNA ladder was purchased from Fermentas International, Inc., (Burlington, Canada). The Transwell chamber was purchased from Chemicon (Temecula, CA, USA).

The full‐length human DKK1 opening reading frame (ORF) was cloned into pcDNA3.1⁺ (Clontech) and pLVX‐DsRed‐Monomer‐N1 (Clontech). Polyethyleneimine (PEI, YEASEN) were used to co‐transfect the lentiviral plasmids pLVX‐DsRed‐Monomer‐N1, psPAX2 (Clontech) and pMD2.G (Clontech). These lentiviral plasmids were co‐transfected at a mass ratio of 5:3.75:1.25 into HEK293T cells. After 48–72 h, the viral supernatants were collected and transduced with polybrene (YEASEN) to the cancer cells for 24 h. After the addition of 1 µg/mL of puromycin for a week, Western blot, real‐time PCR, and Elisa were performed to verify the success of the establishment of stable cell lines.