Hotstartaq dna polymerase

Primer sequences used for RT-PCR were as follows:

Gfap sense 5′AGGCTGGAGGCGGAGAAC3′;

Gfap anti-sense 5′GCTGTGAGGTCTGGCTTGG3′;

Vimentin sense 5′CGTGATGTCCGCCAGCAGTATG3′;

Vimentin anti-sense 5′GGCATCCACTTCGCAGGTGAG3′;

Collagen IV sense 5′AAGGCGAGGAAGGCATCATG3′;

Collagen IV anti-sense 5′GGGTGAGTAGGCTGGAGGTC3′;

Hprt sense 5′ATGGACTGATTATGGACAGGACTG3′;

Hprt anti-sense 5′GCAGGTCAGCAAAGAACTTATAGC3′.

PCR was performed using HotStarTaq DNA polymerase (Quiagen) for 34 cycles. Quantification of band intensity was done using ImageLab software.

GFP transcription was confirmed by RT-PCR in a two steps reaction using total RNA isolated with Trizol/Chloroform from all microinjected cysts 24 h after transfection. Reverse transcriptase cDNA synthesis on total RNA using oligo-dT primers, was carried out using SuperScript^™ III First-Strand (Invitrogen), followed by a nested PCR with Hot StarTaq DNA polymerase (Quiagen), using two sets of GFP primers: forward 5′ AAGGAGAAGAACTTTTCACTGG and reverse; 5′CCGTACCTACTCGAGATGTTT for the initial amplification of a 707 bp fragment, and a second pair: 5′ AAGGAGAAGAACTTTTCACTGG and 5′GTTTTAAGCGGTGTTGTAAC, for the amplification of a 228 bp fragment. Total RNA isolated from Hek 293 cells (Graham et al. 1977 (link)), transfected by lipofection with GFP-TOPO, was also included as positive control. Electrophoresis of PCR products was carried out in 1 % agarose gels in TAE (Tris–Acetate-EDTA) with 0.25 mg/mL Ethidium Bromide (Bio-Rad Laboratories). Gels were visualized and photographed with a Bio-Imaging System (MiniBis pro, DNS). In order to rule out the possibility that the GFP-TOPO plasmid used for microinjection could remain as template during the RT-PCR described above, separate nested PCR amplifications were carried out (excluding the reverse transcriptase reaction), using the same two sets of primers and the same total RNA isolated from the plasmid microinjected cysts.

Primer pairs were designed to amplify the coding sequence and flanking splices sites for all 23 canine ADAMTS17 exons using gene sequences derived from the Ensembl genome browser (http://www.ensembl.org/index.html) (S1 Table). Resequencing of the exons was performed after PCR amplification of genomic DNA in all POAG cases. PCRs were carried out in 12 μl reactions consisting of 0.6 U Qiagen HotStarTaq DNA polymerase and 1 x PCR buffer (Qiagen, Manchester, UK), 200 μM dNTPs (Fisher Scientific—UK Ltd, Loughborough, UK), 0.83 μM forward and reverse primer (Integrated DNA Technologies, Leuven, Beligum) and 10 ng template genomic DNA. The Qiagen Q solution additive (1 x) was used for GC rich amplicons (exons 1 & 2) (Qiagen, Manchester, UK). Reaction mixtures were subjected to a thermal cycling program of 95°C for 10 min, followed by 35 cycles of 95°C for 30 s, 30 s at the annealing temperature (S1 Table) and 72°C for 1 min and a final elongation stage of 72°C for 10 min. ADAMTS17 exome libraries for Illumina sequencing were made using the Nextera XT DNA Library Preparation Kit as per the manufacturer’s instructions (Illumina, San Diego, USA). Sequencing of all POAG cases was performed on the Illumina MiSeq platform, generating a dataset of 75 bp paired-end reads. Next generation sequencing results were confirmed for all POAG cases by Sanger sequencing.