cDNA synthesis was performed using MMLV RT-kit (Evrogen). qPCR was performed using qPCRmix-HS SYBR (Evrogen) with gene-specific primers (Additional file 1 : Table S2) in CFX96 Touch Real-Time PCR Detection System (Bio-Rad). mRNA expression was normalized to the housekeeping gene GAPDH. All group samples were set up in triplicate.
Qpcrmix hs sybr
Manufactured by Evrogen
Sourced in United States
QPCRmix-HS SYBR is a ready-to-use 2x concentrated master mix for real-time quantitative PCR (qPCR) using SYBR Green I as a detection dye. The mix contains all necessary components for efficient and specific qPCR amplification, including a hot-start DNA polymerase, dNTPs, and optimized buffer.
Automatically generated - may contain errors
Lab products found in correlation
Mmlv rt kit, by Evrogen (20 mentions)
Dtlite software, by DNA-Technology (11 mentions)
Dtlite real time pcr system, by DNA-Technology (11 mentions)
Trizol, by Thermo Fisher Scientific (10 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (9 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (8 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (8 mentions)
Dnase 1, by Thermo Fisher Scientific (7 mentions)
Lightcycler 480 real time pcr system, by Roche (6 mentions)
Revertaid h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (6 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (6 mentions)
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Aurum total rna mini kit, by Bio-Rad (5 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (5 mentions)
Cfx96 real time detection system, by Bio-Rad (5 mentions)
Superscript 3, by Thermo Fisher Scientific (4 mentions)
Cfx software, by Bio-Rad (4 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (4 mentions)
Extractrna, by Evrogen (3 mentions)
Cfx96 real time pcr system, by Bio-Rad (3 mentions)
88 protocols using qpcrmix hs sybr
1
qPCR Analysis of Gene Expression
2
Quantifying Algicidal and Silicon Starvation Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specific primers (Table 2 ) were developed with the use of Primer-BLAST [104 (link)]. Since UaMC2 and UaALDH12 genes contain introns in their structure, the primers were adjusted to sites at the boundary of two exons, allowing amplification of a fragment using only cDNA. Primer dimer analysis was performed with OligoAnalyzer Tool from ITD [105 (link)]. Next, 25 μL of premix with a SYBR Green I intercalating dye. Five qPCRmix-HS SYBR (Evrogen, Moscow, Russia) dyes were used for reaction, according to manufacturer’s recommendations. A reaction mix without cDNA was used as a negative control. The relative gene expression was assessed via reference gene valuation followed with the delta-delta Ct method [85 (link)]. Reference gene candidates were selected by analyzing the literature [106 (link),107 (link)] and using RefFinder software (available at https://blooge.cn/RefFinder ) [108 (link)]. Two genes having the most stable expression were chosen: 18S rRNA—the most stable under algicidal exposure and prolonged culture—and E2 (ubiquitin-conjugating enzyme)—the most stable under silicon starvation.
3
qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized from 1-mg total RNA using random hexanucleotides and SuperScript III reverse transcriptase (Life Technologies, USA) according to the manufacturer’s protocol. qPCR was performed using qPCRmix-HS SYBR (Evrogen, Russia) in a LightCycler 480 Real-Time PCR system (Roche, Switzerland) at the following cycling conditions: 95°C for 20 s, 61°C for 20 s, and 72°C for 30 s repeated 40 times. Three biological and nine technical replicates were used to ensure reproducibility, and the results were analyzed by LinRegPCR v 2014.6. The results were normalized against 16S rRNA to correct the sample-to-sample variation. Calculations were performed according to Ganger et al. (2017) (link) for the relative expression ratio. PCR primers are listed in Supplementary Table 1
4
Quantifying Gene Expression in Stimulated DCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from non-stimulated human DCs and from DCs stimulated with Hz using the TRIzol (Invitrogen, USA) extraction method followed by purification on columns (Qiagen, UK). Total RNA was reverse transcribed into cDNA following the protocol for RevertAid First-Strand cDNA Synthesis Kit (Thermo Fisher). The cDNAs were amplified using PCR with gene-specific primers designed by using CLC Main Workbench 7.0 (CLC Bio, Aarhus, Austria). Each PCR was carried out in duplicate with optimized primer concentrations using qPCRmix-HS SYBR (Evrogen, Russia) in a thermal cycler CFX-96 (Bio-Rad), with the following thermal cycling conditions: one cycle of 10 min denaturation at 95°C; 34–37 cycles of 1 min at 94°C, 1 min at 53–57°C, and 1 min at 72°C; and a final extension step at 72°C for 10 min. A dissociation curve was included in each run to ensure specificity of amplification. Beta-actin (ACTB) was used as the reference gene. The relative expression of genes was calculated using delta-delta Ct method; data were expressed as fold change compared with the untreated group (38 (link)).
5
Real-Time PCR Sensitivity Determination
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was performed in a final volume of 10 μL. The reaction mixture included 2 μL of Evrogen qPCRmix-HS SYBR, 0.3 mM of each primer, and 20 ng of template DNA. The final concentration of dNTP was 0.12 mM, and the concentration of magnesium was 3 mM. Thermal cycling was performed on a LightCycler 96 (Roche, Basel, Switzerland) in the following mode: 94 °C for 300 s, then 45 cycles of 94 °C for 10 s, 65 °C for 10 s, and 72 °C for 10 s. All experiments were carried out in duplicate per run and repeated twice. Thus, there were four technical replicates. The processing of the amplification curves and calculation of the threshold cycles were carried out using Roche software. Reactions with water were used as a negative control and with a test plasmid as a positive control.
For the experiment to determine the detection sensitivity, tenfold dilutions of the test plasmid and genomic DNA Ac-1923 (← DSM 20129) were prepared. PCR was performed with each dilution in the same way as described above.
For the experiment to determine the detection sensitivity, tenfold dilutions of the test plasmid and genomic DNA Ac-1923 (← DSM 20129) were prepared. PCR was performed with each dilution in the same way as described above.
6
Quantification of microRNA Levels with qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Levels of selected microRNA were evaluated by qPCR. To remove heparin traces, RNA was treated with heparinase (Sigma) as was described before (41 (link)). For reverse transcription and qPCR microRNA-specific TaqMan Assays, TaqMan MicroRNA Reverse Transcription Kit and TaqMan Universal Master Mix II no UNG (all Thermo Fisher Scientific) were used according to manufacturer's recommendations. For miR-3679-5p measurement, a reverse transcription stem-loop primer and a primer pair for amplification were designed using sRNAPrimerDB online service (42 (link)). In this case, reverse transcription was performed using TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific), and real-time PCR was performed using qPCRmix-HS SYBR (Evrogen). TaqMan Assays and designed primer sequences are indicated in Supplementary Table 1 .
7
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One microgram of total RNA was used for cDNA synthesis with random hexanucleotides and SuperScript III reverse transcriptase (Life Technologies). qPCR was performed using qPCRmix-HS SYBR (Evrogen, Russia) and the LightCycler 480 Real-Time PCR system (Roche, Switzerland); cycling conditions were as follows: 95° for 20 s, 60° for 20 s, 72° for 30 s, repeat 40 times; gene-specific primers are listed in Supplementary Table S1 . Amount of 16S rRNA in each sample was used as a reference.
8
Quantitative Analysis of Gene Expression in Mouse Lungs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Identical lobes of the right lungs from 4-5 individual mice per group per time point were isolated and immediately put into RNA lysis buffer. Total RNA was isolated using the commercial SV Total RNA Isolation System (Promega). Reverse transcription of mRNA was performed using oligo(dT) primers, dNTP mix, M-MLV RT and RNasin® (Promega). Quantitative real-time RT-PCR (qPCR) of cDNA was performed using qPCRmix-HS SYBR (Evrogen) and cfx-96 Real-Time PCR Detection System (BioRad). The following primers were used:
Relative expression levels were calculated by normalizing levels for genes of interest to that of hprt using the 2–ΔΔCt method.
Statistical analysis was performed using GraphPadPrism7 software. Representative data from one of two identical experiments are displayed, except survival curves for which combined results from two independent experiments were summarized. The log-rank test for survival and One- or Two-way Anova with Tukey post-test for multiple comparison for other experiments were used. P < 0.05 was considered statistically significant.
Relative expression levels were calculated by normalizing levels for genes of interest to that of hprt using the 2–ΔΔCt method.
Statistical analysis was performed using GraphPadPrism7 software. Representative data from one of two identical experiments are displayed, except survival curves for which combined results from two independent experiments were summarized. The log-rank test for survival and One- or Two-way Anova with Tukey post-test for multiple comparison for other experiments were used. P < 0.05 was considered statistically significant.
9
Quantitative RT-PCR analysis of M3-receptor expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For real time PCR was used isolated atria and ventricles tissues from 3 groups of animal. After preparation samples were dipped into RNA stabilization solution (IntactRNA, Evrogen, Russia) for 24 h at 4 °C and stored at 20 °C before used. RNA was extracted from samples with the usage of acid-guanidine-phenol-chloroform method (ExtractRNA, Evrogen, Russia). RNA was treated from genomic DNA with the usage of DNase I (2000 е.а./ml, NEB,USA) for 60 min at 42 °C. Total RNA (500 ng) was reverse-transcribed by MMLV RT kit this random primers (Evrogen, Russia) according to the protocol recommended by the manufacturer.
Quantitative RT-PCR was carried out in a total volume 25 μl containing qPCRmix-HS SYBR (Evrogen, Russia) containing intercalating fluorescent dye SYBR Green I. The assay was performed using PCR detection system BioRad CFX96. Melting was initiated at 95 °C during 5 min. The cycling profiles were consisted of denaturation of 1 min at 95 °C, annealing of 30 s at 60 °C, extension of 30 s at 72 °C, for 50 cycles and final step of 10 min at 72 °C.
Sequences for primers were as follows: M3-receptors - СAAGTGGTCTTCATTGCCTTCT (forward), GCCAGGCTTAAGAGGAAGTAGTT (reverse) and GAPDH - CAGCGATGCTTTACTTTCTGAA (forward), GATGGCAACAATGTCCACTTT (reverse). For standard curves for RT-PCR was used serially diluted genomic DNA from rat liver.
Quantitative RT-PCR was carried out in a total volume 25 μl containing qPCRmix-HS SYBR (Evrogen, Russia) containing intercalating fluorescent dye SYBR Green I. The assay was performed using PCR detection system BioRad CFX96. Melting was initiated at 95 °C during 5 min. The cycling profiles were consisted of denaturation of 1 min at 95 °C, annealing of 30 s at 60 °C, extension of 30 s at 72 °C, for 50 cycles and final step of 10 min at 72 °C.
Sequences for primers were as follows: M3-receptors - СAAGTGGTCTTCATTGCCTTCT (forward), GCCAGGCTTAAGAGGAAGTAGTT (reverse) and GAPDH - CAGCGATGCTTTACTTTCTGAA (forward), GATGGCAACAATGTCCACTTT (reverse). For standard curves for RT-PCR was used serially diluted genomic DNA from rat liver.
10
Quantitative RT-PCR of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CDNA was synthesized from 1 mg total RNA using random hexanucleotides and SuperScript III reverse transcriptase (Life Technologies, USA) according to the manufacturer’s protocol, and used as a template in qRT-PCR performed with qPCRmix-HS SYBR (Evrogen) in a LightCycler 480 Real-Time PCR system (Roche, Switzerland) at the following cycling conditions: 95 °C for 20 s, 61 °C for 20 s, and 72 °C for 30 s, repeated 40 times. Three biological and nine technical replicates were used to ensure reproducibility, and the results were analyzed by LinRegPCR v 2014.6. The data were normalized against 16S rRNA to correct for sample-to-sample variation and the relative expression ratios were determined as described earlier [39 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!