Calphos mammalian transfection kit

For the transfection of miR-326-3p, miR-330-3p, pcDNA-Rpph1-wt and pcDNA-Rpph1-mutant into Neuro-2a cells, 4 × 10⁵ cells were seeded in a 35-mm dish. A 100 nM mimic or negative control was transfected using the Lipofectamine 3000 reagent (Life technologies) the next day in DMEM with 10% FBS. After 12 h, the same transfection procedure was performed again. Cells were lysed for protein collection 72 h after the second transfection. For dendritic spine study, 1.5 × 10⁵ dissected hippocampal neurons were seeded into one well of a 24-well plate. Calcium transfection was performed at DIV9 using a CalPhos^TM Mammalian Transfection Kit (Clontech). 1 μg pcDNA-Rpph1 and pcDNA vector backbone or 100 nM Rpph1 siRNA was co-transfected with pEGFP at a molar ratio of 4:1. Cells were fixed at DIV15. For the RNA interference study, 100 nM Rpph1 siRNA (5′-AAGAGUGACACGCACUCAGCACGUG-3′) was transfected into Neuro-2a cells using Lipofectamine 3000 reagent, with high-GC siRNA (Invitrogen) as the negative control. SiRNA transfection efficiency was tested by transfecting Alexa fluor 555-labeled scrambled siRNA (Invitrogen) into Neuro-2a cells (Supplementary Figure S2A). Three siRNA candidates were employed under the same transfection protocol (Supplementary Figure S2B).

Primary hippocampal cultures were prepared from embryonic day 16 ICR mice as described previously^{60 (link)} with slight modifications. Briefly, hippocampi were dissected and were incubated with papain (90 units/mL, Worthington) for 20 min at 37 °C. After digestion, hippocampal cells were plated onto poly-D-lysine-coated coverslips in 24- or 12-well plates (Falcon) at a density of 20,000 cells/cm² and kept in a 5% CO₂ humidified incubator. At 2–4 days in vitro (DIV), 40 μM FUDR (Sigma) and 100 μM uridine (Sigma) were added to inhibit the growth of glial cells. One-fifth of the culture medium was replaced with fresh medium every 2–4 days. Cultures were transfected with plasmids encoding either PMCA1-SEP, SypHy, or Syntaxin-1a-SEP at 5–7 DIV using CalPhos^TM mammalian transfection kit (Clontech) in accordance with a calcium phosphate transfection method which is optimized for neuronal cultures^{61 (link)}, and were subjected to experiments at 12–14 DIV. Animals for the primary neuron cultures were treated according to our institutional guidelines for the care and use of animals (Doshisha University).

For the generation of lentivirus, HEK293T cells cultured in 15 cm plate and transfected with control shRNA or IRGM shRNA (Santa Cruz #TRCN0000197363; Sequence: CCGGCCGGTATGACTTCATCATGGTCTCGAGACCATGATGAAGTCATACCGGTTTTTTG) plasmid (22.5 μg), the pMD2G plasmid (7.9 μg) and pCMVR 8.74 (14.6 μg) using CalPhos Mammalian Transfection Kit (Clonetech #631312). After 36 h of transfection, the viruses in the culture medium were harvested and centrifuged at 500 g for 5 min at 4°C. Culture medium was then filtered through 0.22 μm filter and used for the transduction and generation of stable cell lines.
For the generation of stable IRGM knockdown cells, HT29 cells were plated in six‐well plates and transduced with virus particles. After 24 h, the medium was replaced and kept for another 48 h. IRGM stable knockdown cells were selected using 2 μg puromycin for 1 week. IRGM knockdown was confirmed by western blotting using anti‐IRGM antibody and qRT–PCR using IRGM TaqMan gene expression assay.

DMSO, polybrene, and PEG 8000 (polyethylene glycol) were obtained from Sigma-Aldrich (Merck). DNA and RNA transfection at the indicated concentrations was performed using the CalPhos Mammalian Transfection Kit (Clonetech) and Lipofectamine RNAiMAX (Thermo Scientific) according to the manufacturers’ instructions, respectively. The ORF-encoding lentivirus constructs for validations were obtained from the RNAi Platform, Broad Institute of MIT and Harvard (Cambridge, MA, USA). Cell viability/proliferation was assessed using PrestoBlue Cell Viability Reagent (Invitrogen) according to the manufacturer’s instructions. Cell toxicity was assessed using LDH-Glo cytotoxicity assay (Promega) in the supernatant according to the manufacturer’s instructions. Palbociclib and LEE011 (Ribociclib) were obtained from Synkinase and Sellekchem, respectively.