Rotor gene qpcr system

For miRNA expression analysis, the total RNA was extracted from cell culture media by using TRIzol (Invitrogen, Carlsbad, CA, USA). Reverse-transcription of RNA was performed using the miRCURY LNA RT Kit according to the manufacturer’s instructions (Qiagen). qRT-PCR assays were carried out in a Rotor-Gene^®Q PCR System (Qiagen) using a miRCURY LNA SYBR^® Green PCR Kit and miRCURY LNA miRNA PCR Assay according to the manufacturer’s instructions (Qiagen). Briefly, each reaction was performed in a final volume of 10 μL containing two μL of the cDNA, a master mix containing 5 μL of 2× miRCURY SYBR Green PCR Master Mix, 1 μL of miRCURY LNA miRNA PCR Assay, and RNase-free water. The amplification profile was: PCR initial heat activation at 95 °C for 2 min, followed by 40 cycles of denaturation at 95 °C for 10 s and combined annealing/extension at 56 °C for 60 s. The expression of mir-146b and mir-223 was normalized to RNU6B and calculated as 2-^ΔΔCt.

RNA was exacted the liver tissue using TRIzol Reagent (Invitrogen, Australia) and reverse transcribed using a high capacity cDNA reverse transcription kit (Applied Biosystems, Australia) according to the manufacturer’s instructions. Primers (GeneWorks, Australia) and SYBER green supermix (Bio-Rad, USA) were used for quantitative real time PCR. The primer sequences for FoxO1 were: forward 5’-TTCAATTCGCCACAATCTGTCC-3’ and reverse 5’-GGGTGATTTTCCGCTCTTGC-3’. All reactions were performed on QIAGEN Rotor-Gene Q PCR system (Germany). 18s was used as the normalizing control gene.

All real-time qPCR assays were performed in triplicate on a Qiagen Rotor Gene qPCR system (Qiagen, Germany). The 16 S rRNA gene amplified by the total bacterial primers was used as a housekeeping gene to target an approximately 180-bp region. The ring-hydroxylating dioxygenase (RDH) gene^{51 (link)} and alkane 1-monooxygenasegene (alkB) gene^{18 (link)} were chosen to quantify the polycyclic aromatic hydrocarbon- (PAH-) and alkane-degrading functional groups. PCR amplification was performed in a total volume of 50 μL containing 25 μL of FastStart Universal SYBR Green Master (ROX, Germany), 1 μL of DNA template and 0.5 μM of each primer. The thermocycling steps for qPCR amplification were as follows: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s. The PCR products were visualized and checked by agarose (1%) gel electrophoresis in the presence of DL2000 markers (Takara, Japan). The relative abundance of the functional group was normalized by targeting the gene expression against the 16 S rRNA of each genomic DNA sample using the 2^_CT method^{52 (link)}.

Total RNA was extracted by using TRIzol extraction reagent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA synthesis was performed using the Revert Aid RT Kit, in accordance with manufacturer’s instruction (Thermo Scientific, Waltham, USA. qRT-PCR assays were carried out in Rotor-Gene^®qPCR System (Qiagen, Hilden, Germany), using SsoAdvanced Universal SYBR Green Supermix (Biorad, Hercules, CA, USA). Briefly, each reaction was performed in a final volume of 10 μL containing 1 μL of the cDNA, 1 μL of forward and 1 μL of reverse primers, 5 μL of SsoAdvanced Universal SYBR Green Supermix and 1 μL of nuclease-free water. Primers were designed based on the mouse GenBank sequences for IL-6, IL-1β, and TNFa, and are reported in Table 6. The amplification protocol was based on an initial heat activation at 95 °C for 30 s, followed by 35 cycles of denaturation at 95 °C for 15 s and combined annealing/extension at 60 °C for 30 s. The relative expression of mRNA was normalized by β-Actin and calculated by the 2^−ΔΔCt method.

RNA was extracted using RNeasy Kit (Qiagen), while RNA extract was reverse-transcribed using a High capacity cDNA reverse transcription kit (Life Technologies, Australia) according to the manufacturer’s instructions. Bioinformatically validated Taqman Primers (Life Technologies, Australia) including glyceraldehydephosphate dehydrogenase (Gapdh, Mm03302249 g1), IL-6 (Il6, Mm00446190 m1), IL-1β (Il1β, Mm00434228 m1), TNFα (Tnfα, Mm004432458 m1), TGFβ (Tgfb1, Mm01178820 m1), Col1 (Col1a1, Mm00801666 g1), α-SMA (Actin 2, Mm00725412 s1), NOX2 (Cybb, Mm01287743 m1), NOX4 (Nox4, Mm00479246 m1), HMOX1 (HO-1, Mm00516005 m1), CD68 (Cd68, Mm03047343 m1), glutathione peroxidase (Gpx1, Mm00656767 g1).
All reactions were performed at 50°C for 2 min, 95°C for 3 min, 40 cycles of 95°C for 15 s, 72°C for 30 s and followed by measurements of melt curve using QIAGEN Rotor-Gene Q PCR system (Germany). All reactions were performed in triplicates and GAPDH was used as the normalizing control gene and results were analyzed by the ΔΔCt method.

RNA was extracted using TRIzol reagent (Invitrogen, #15596026) and genomic DNA was digested using amplification grade DNase (Invitrogen, #18068-015, Australia). RNA extract was reverse-transcribed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems, #4368814, Australia) according to the manufacturer’s instructions. Primers (GeneWorks, Australia) and SYBR green supermix (Bio-Rad, #170-8880, U.S.A.) were used for quantitative real-time PCR using QIAGEN Rotor-Gene Q PCR system (Germany). 18s was used as the normalising control gene and results were analysed by the ΔΔC_t method. Sequences of the primers were: PGC1α AAACTTGCTAGCGGTCCTCA (forward) and TGGCTGGTGCCAGTAAGAG (reverse); UCP3 TGTCAACCAACTTCTCTAGGATAAGG (forward) and CACTGTTGTCTCTGCTGCTTCTG (reverse); and 18S CGCCGCTAGAGGTGAAATTCT (forward) and CGAACCTCCGACTTTCGTTCT (reverse).