The largest database of trusted experimental protocols

Mpk5000

Manufactured by Thermo Fisher Scientific
Sourced in United States

The MPK5000 is a laboratory equipment product from Thermo Fisher Scientific. It serves as a multi-purpose instrument with core functionality for various laboratory applications. The detailed specifications and intended uses are not available in this factual, unbiased response.

Automatically generated - may contain errors

51 protocols using mpk5000

1

CRISPR-Mediated Genome Editing in PFF and PK15 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
1 × 105 PFF cells were harvested and resuspended in 10 μL electroporation buffer (MPK5000S, Invitrogen, Carlsbad, CA, USA) supplemented with hCas9, sgRNA, and reporter (molar ratio of Cas9:sgRNA:donor was 1:1:2, with a total of 2 μg). Reporter was digested with AhdI (R0584S, New England Biolabs) before transfection. The mixture was transfected into PFF cells using the Neon™ Transfection System (MPK5000, Invitrogen), with 1350 V/30 ms and 1 pulse. Subsequently, transfected cells were transferred to 12-well plates (3513, Corning, Corning, NY, USA), and EGFP expression was observed 48-h after transfection using fluorescence microscopy (Olympus, Shinjuku, Tokyo, Japan).
3 × 105 PK15 cells were seeded into 12-well plates and reached 70–80% confluency at the time of transfection. 750 ng DNA (molar ratio of Cas9:sgRNA:reporter was 1:1:2) was transfected using 2.25 μL of GenJet™ In Vitro DNA Transfection Reagent (SL100489, SignaGen, Rockville, MD, USA). EGFP expression was observed 48 h post-transfection using fluorescence microscopy.
+ Open protocol
+ Expand
2

CRISPR/Cas9 Genome Editing in ES Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
TracrRNA, crRNA, and Cas9 protein were purchased from IDT (Coralville, IA, USA). TracrRNA and crRNA were dissolved in Duplex Buffer (IDT, 200 µM each) and annealed in a thermal cycler at 95 °C for 10 min followed by − 1 °C/min stepdown cycles until 25 °C. Annealed RNA (100 µM) were then incubated with 3 µg/µL Cas9 protein at 37 °C for 20 min to form Cas9-RNP. A Neon Transfection System (MPK5000, ThermoFisher) was used for electroporation of plasmid and Cas9-RNP into ES cells. In brief, 1 × 105 ES cells with 1 µg of targeting vector were electroporated with or without all-in-one CRISPR/Cas9 vector (0.5 µg) or Cas9-RNP (at a final concentration of 10 µM annealed RNA and 0.3 µg/µL Cas9 protein) in a 10 µL tip (MPK1096, Thermo). The Neon system used two pulses at 1200 V and 20 ms or a single pulse at 1400 V and 30 ms for all-in-one vector transfection or Cas9-RNP transfection, respectively. Electroporated ES cells were cultured in ESCM with or without MEFs.
+ Open protocol
+ Expand
3

Knocking Down NLRC3 in Primary Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary ear fibroblasts were transfected with a small interfering RNA (siRNA) from siGENOME smart pools with the assistance of the Neon Transfection System (MPK5000, ThermoFisher Scientific). The siGENOME SMARTpool siRNA specific for the gene encoding mouse NLRC3 (M-052823-01, Dharmacon) and a control siRNA pool were used. Sequences for siRNA are listed in Supplementary Information. After 48 h of transfection, cells were stimulated with IGF-1 as described above.
+ Open protocol
+ Expand
4

Cell Viability Assay with siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
MT2 and C8166-45 cells (1 × 106) were transfected with 50 nM siNC, or NPM1/B23-specific siRNA-21 and siRNA-22 using the Neon® Transfection System and transfection kit (Thermofisher Scientific Inc., MPK5000 and MPK1096). Cells were next seeded into triplicate wells on 96-well plate. After 48 h, 10 μl Cell counting KIT-8 buffer (CCK-8, Sigma-Aldrich) was added into each well and incubated for 4 h at 37°C. Absorbance was measured at 450 nm with the EnSpire 2,300 Multilabel Reader (PerkinElmer) at room temperature.
+ Open protocol
+ Expand
5

Transfection of Inflammasome Activators

Check if the same lab product or an alternative is used in the 5 most similar protocols
For co-IP, cells were transfected using the CaCl2 method as previously described (79 (link)). Flagellin and dsDNA poly (dA:dT) were transfected with DOTAP reagent (Roche, 11202375001) to activate inflammasomes. The NeonTM transfection system (Thermo Fisher Scientific, MPK5000) was used for the transfection of tRPE cells with pCMV3-HA-hPLK1 or pCMV5-BASU-GS3-Plk1, according to the manufacturer’s instructions. Cells were then incubated in a cell culture medium without antibiotics overnight before any experiment was conducted.
+ Open protocol
+ Expand
6

Knocking Down NLRC3 in Primary Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary ear fibroblasts were transfected with a small interfering RNA (siRNA) from siGENOME smart pools with the assistance of the Neon Transfection System (MPK5000, ThermoFisher Scientific). The siGENOME SMARTpool siRNA specific for the gene encoding mouse NLRC3 (M-052823-01, Dharmacon) and a control siRNA pool were used. Sequences for siRNA are listed in Supplementary Information. After 48 h of transfection, cells were stimulated with IGF-1 as described above.
+ Open protocol
+ Expand
7

Prednisolone Regulation of a Genetic Variant

Check if the same lab product or an alternative is used in the 5 most similar protocols
A 300-bp of sequence centered on reference or the alternative allele of rs7045812 was cloned upstream of the minimal promoter in pGL4.23 (Promega, E841A). Nalm6 cells were transfected with constructs using the Neon transfection system (Thermo Fisher, MPK5000). Following an overnight incubation after transfection, cells were treated with 5uM prednisolone or vehicle control for 6 h before luciferase was measured using the Dual Luciferase Reporter Assay System (Promega, E1960).
+ Open protocol
+ Expand
8

CRISPR-Mediated Gene Knockout in Activated OT-1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following guide RNA sequences were purchased from Integrated DNA Technologies: eIF5a (TGCTCAGCATTACGTAAGAA and CTTCGAGACAGGAGATGCAG), Dhps (ATACCTCGTGCAGCACAACA), Dohh (GCAGTATTCTACGGACCCAG), Thy1 (ACAGACAAGCTGGTCAAGTG), and TRAC guide RNA (CAGGGTTCTGGATATCTGT). Cas9 ribonucleoprotein complexes were formed by mixing 2 µL of 100 µM tracrRNA and 2 µL of 100 µM crRNA in 25 µL Nuclease-free duplex buffer (Integrated DNA Technologies 11-05-01-12), incubating at 95 °C for 5 min and then mixed with 2 µL of 5 mg/mL Truecut Cas9 protein (Thermo Fisher Scientific A36499) for 10 min at 37°. The RNP complexes were made immediately before the transfection and mixed with 106 2-day activated OT-1 cells. Transfections were performed with the Neon transfection system (Thermo Fisher Scientific MPK5000) following manufacturer’s instructions, with the setting 1600V, 10 ms, 3 pulses. Following transfection cells were cultured in IL-2-containing media for 3 days for eIF5a KO, and 4 days for Dhps and Dohh KO.
+ Open protocol
+ Expand
9

Prednisolone Regulation of Genetic Variant

Check if the same lab product or an alternative is used in the 5 most similar protocols
A 300-bp of sequence centered on reference or the alternative allele of rs7045812 was cloned upstream of the minimal promoter in pGL4.23 (Promega, E841A). Nalm6 cells were transfected with constructs using the Neon transfection system (Thermo Fisher, MPK5000). Following an overnight incubation after transfection, cells were treated with 5uM prednisolone or vehicle control for 6 h before luciferase was measured using the Dual Luciferase Reporter Assay System (Promega, E1960).
+ Open protocol
+ Expand
10

Luciferase Assay for Transcriptional Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
K562 cells were suspended in R buffer, mixed with 450 ng of empty pGL4.23 or 500 ng of pGL4.23 containing tested element and 100 ng of pGL4.74 and were electroporated in 10 μL volume with the Neon transfection system (Thermo Fisher Scientific, MPK5000) by 3 pulses of 1450 V for 10 msec each. After adding 65 μL of RPMI 1640 supplemented with 10% FBS, cells were cultured in 96-well plates for 24 h. All tested vectors were replicated 6 times. Cells were transferred to 96-well white plates before assay (Greiner, 655075). Dual-Glo Luciferase assay system (Promega, E2940) was used to measure Firefly and Renilla luciferase activity with the product’s protocol and their luminescence was detected by using SpectraMax i3 (Molecular Devices). Firefly/Renilla ratio of luminescence was used for the activity of each replicate.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!