The largest database of trusted experimental protocols

9 protocols using doxycycline

1

Pharmacological Modulation of Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
The activators and inhibitors used in this study were obtained from the following sources: ISO (Sigma), Forskolin (FSK, LC Laborartoy), IBMX (Adipogen), ICI (Tocris), PKI (Tocris), PRO (Tci America), GSK126 (Selleck), DZNEP (Cayman Chemical), EPZ6438 (Selleck), TSP1 peptide (Athens Research and Technology), MDV3100 (Apexbio) and Doxycycline (Enzo), TSA (Cayman). The doses and duration of their treatments were as indicated.
+ Open protocol
+ Expand
2

Establishing TICRR Mutant Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
For stable TICRR mutant lines, U2OS Flp-In TRex cells (gift of Jeffrey Parvin) were cotransfected with Flp recombinase (Invitrogen, pOG44) and TICRR constructs using TransIT-LT1 reagent (Mirus Bio). Stably integrated clones were grown in DMEM with 10% FBS and selected with 100 μg/mL hygromycin. To induce expression of TICRR constructs, 2.5 μg/mL doxycycline (Enzo) was added to the medium for 24–96 h. The TICRR siRNA (CCUGUUACGCCAAAGAAACUGUUUA) (Kumagai et al. 2010 (link)) or a control siRNA (lowGC) (Stealth siRNAs) were purchased from Life Technologies and transfected with RNAimax (Life Technologies) according to the manufacturers’ instructions.
+ Open protocol
+ Expand
3

Differentiation of Embryonic Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
ESCs were maintained on embryonic fibroblasts using standard conditions (Ernst et al., 2004b (link)). For in vitro differentiation, single-cell suspensions from dissociated ESC cultures were seeded at 10,000–20,000 cells/mL in Petri dishes (Fisher) with orbital rotation (50 rpm, Labnet Orbit 1000). The differentiation medium was Iscove's modified Dulbecco's medium (Mediatech) containing 15% fetal bovine serum (Gibco), 2 mM L-glutamine (Mediatech), 1% penicillin/streptomycin (Mediatech), 200 μg/mL holo bovine transferrin (Millipore), 4.5 × 10−4 M monothioglycerol (Sigma) and 50 μg/mL ascorbic acid (Sigma). Doxycycline (Enzo Life Sciences) was added to the differentiation medium at 1–2 μg/mL for the times indicated in each figure legend.
+ Open protocol
+ Expand
4

Activator and Inhibitor Compound Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The activators and inhibitors used in this study were obtained from the following sources: Isoproterenol (ISO) (Sigma), Forskolin (FSK, LC Laborartoy), IBMX (Adipogen), ICI118,551 (ICI) (Tocris), propranolol (PROP) (Tci America), protein kinase A inhibitor peptide 14-22 (PKI) (Tocris), GSK126 (Selleck), EPZ-6438 (Selleck), DZNeP (Apexbio), MDV3100 (Apexbio) and Doxycycline (Enzo). The doses and duration of their treatments were as indicated. ISO, PROP, ICI, PKI and Doxycycline were dissolved in water, while all other chemicals were dissolved in DMSO.
+ Open protocol
+ Expand
5

Tracing Cellular Dynamics in Buccal Mucosa

Check if the same lab product or an alternative is used in the 5 most similar protocols
2 to 4 month old male and female K5tTa;H2BGFP mice were used (n≥3 mice per chase time point). To inhibit expression of the H2BGFP allele, mice were initially given an intraperitoneal injection of doxycycline (0.4mg, Enzo Life Sciences, ALX-380–273-G005) and were then maintained on mouse chow that contained doxycycline (200mg/kg, BioServ, S3888). Mice were subsequently euthanized at 0 days (baseline), 3 days, 7 days, 21 days, 6 weeks, and 3 months after doxycycline treatment. The buccal mucosa in each mouse was removed, the epithelium separated from the underlying connective tissue, stained with DAPI in PBS for 30 minutes at room temperature, rinsed 2×5 minutes in PBS, and mounted onto glass slides as already described. Tissues were imaged in two ways. First, confocal microscope settings (e.g. laser power, exposure time, binning, gain, etc.) were adjusted to maximize the EGFP signal in the baseline K5tTa;H2BGFP samples (i.e. did not receive any doxycycline), without overexposing them and over-saturating the microscope camera. These same microscopic imaging parameters were then used to image the remaining K5tTa;H2BGFP samples in order to determine the relative differences in fluorescence between them. Next, optimized confocal settings were adjusted for each sample to maximize EGFP expression in order to detect any rare, label retaining cells at later chase time points.
+ Open protocol
+ Expand
6

Prostate Cancer Cell Lines Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols
The androgen-independent human prostate cancer cell lines PC-3 and DU-145 were obtained from the American Type Tissue Culture Collection and cultured in RPMI 1640 (Invitrogen) containing 10% fetal bovine serum (Invitrogen) and antibiotics (PenicilinG/Streptomycin, 50 µg/mL). DU-145 cells were transfected with pEGFP or talin-1 plasmids and cloned under G418 selection (Life Technologies Bethesda Research Laboratories). For silencing talin-1 expression, the shRNA talin-1 vector (GIPZ shRNAmir talin-1) was used from Open Biosystems (Hunsville, AL) and shRNA talin1 DU-145 prostate cancer cells were selected under puromycin. Polyclonal populations were pooled under selection, and stable cell lines were characterized by immunoblotting. PC-3 cells were stably transfected with pTRIPZ vector containing TRE-ILK shRNA (Thermo Scientific). PC-3 shILK cells were induced with 2 µg/ml doxycycline (Enzo Life Sciences) for two days. DZ-50, a first-generation doxazosin derivative (Shaw et al., 2004; Garrison et al., 2007), was used at a concentration of 5 µM dissolved in DMSO for all treatments. Sterile DMSO was used for control/untreated samples.
+ Open protocol
+ Expand
7

Induction of H2B-GFP Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the short H2B–GFP pulse experiments, mice were injected once intraperitoneally with 200 μl of doxycycline (2 mg ml−1, Enzo Life Sciences, ALX-380–273-G005) and then analysed at various timepoints after treatment (exact chase timepoints are provided in the main text). For the long pulse experiments (Supplementary Fig. 4f), mice were treated once with 200 μl of doxycycline (2 mg ml−1) by intraperitoneal injection. Simultaneously, doxycycline was added continually to their drinking water (1 mg ml−1 supplemented with 5% sucrose) for 3 weeks.
+ Open protocol
+ Expand
8

Monitoring Cell Cycle Progression

Check if the same lab product or an alternative is used in the 5 most similar protocols
HCT-116 colon cancer cells (ATCC CCL-247) were cultured in McCoy's 5A medium (Corning) supplemented with 10% fetal bovine serum (FBS). For mitotic arrest, nocodazole (100ng/mL) was added to the media for 4 h. Cells were collected by manual shake-off and washed four times in phosphate-buffered saline (PBS) before re-seeding in culture medium. Time points were taken at intervals after release to monitor cell cycle progression. Flp-In T-rex 293 cells (Invitrogen, R78007) were cultured in Dulbecco's modified Eagle's medium (DMEM) (Corning) supplemented with 10% FBS. For transgene induction, doxycycline (2.5 ug/ml, Enzo) was added to the medium for 24 h. MG132 (20 uM, Selleck), MLN4924 (3 uM, Cayman Chemical), Palbociclib (100 nM, Selleck), T2AA (hydrochloride), (20 uM, Cayman Chemical), or NU-6102 (20 uM, Cayman Chemical) were added to the cell culture medium for the indicated times.
+ Open protocol
+ Expand
9

Signaling Pathway Modulation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The activators and inhibitors used in this study were obtained from the following sources: Isoproterenol (ISO) (Sigma), Forskolin (FSK, LC Laborartoy), IBMX (Adipogen), ICI118,551 (ICI) (Tocris), propranolol (PRO) (Tci America), protein kinase A inhibitor peptide 14–22 (PKI) (Tocris), GSK126 (Selleck), MDV3100 (Apexbio) and Doxycycline (Enzo). The doses and duration of their treatments were as indicated.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!