The 3′P assay was performed with 21 mer oligos 5′ATGTGGAAAATCTCTAGCAGT 3′, 5′ACTGCT AGAGATTTTCCACAT 3′. For STA 19 mer oligos used were: 5′ATGTGGAAAATCTCTA GCA 3′, 5′ACTGCTAGAGATTTTCCACAT3′ Target DNA, Oligos were: 5′TCGAGAAAAAAAA AACTTAAGCCCCCCCCCCC 3′, 5′TCGAGGGGGGGGGGGC TTAAGTTTTTTTTTTC 3′. One of the 3′P and STA oligos were first labelled at 5′end with [γ-32P] ATP with the help of polynucleotide kinase. The second unlabeled strand is then annealed to it. The unlabelled DNA were removed by column chromatography purification (Qiagen purification kit). Activity assay were performed as described earlier [45 (link)–48 (link)]. The 20 µL reaction mixture contains of 250 nM IN protein, 20 mM HEPES, 5 mM MgCl2, 100 mM NaCl, 5 mM DTT, and 0.1–1 µM of PSF protein. The reaction was incubated on ice and then at 37 °C for half an hour for 3′end processing activity. For strand transfer reaction after addition of labelled donar DNA, target DNA is added and incubated for 1 h at 37 °C. The reaction mixture was then loaded on 15% PAGE and electrophoresed in tris borate buffer, pH 8. The gels were visualized by phosphorimager.
Purification kit
Manufactured by Qiagen
Sourced in Germany, United States
The Purification kit is a comprehensive solution for the isolation and purification of biological molecules such as DNA, RNA, and proteins from various sample types. It utilizes a simple and efficient procedure to extract and concentrate the target analytes, enabling their further analysis and downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Ab13100 dna sequencer, by Thermo Fisher Scientific (3 mentions)
Gotaq dna polymerase, by Promega (3 mentions)
Amplitaq gold dna polymerase kit, by Thermo Fisher Scientific (3 mentions)
Clc bio main workbench, by Qiagen (3 mentions)
Restriction enzyme, by New England Biolabs (3 mentions)
Nanodrop one, by Thermo Fisher Scientific (2 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (2 mentions)
Qiaquick gel extraction kit, by Qiagen (2 mentions)
Geneamp 9700, by PerkinElmer (2 mentions)
Abi3130 1 genetic analyzer, by Thermo Fisher Scientific (2 mentions)
Abi bigdye kit, by Thermo Fisher Scientific (2 mentions)
Instaclone pcr cloning kit, by Thermo Fisher Scientific (2 mentions)
Staphtype software, by Ridom (2 mentions)
Oligo dt 18 primer, by Takara Bio (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Steponeplus, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time system, by Bio-Rad (1 mentions)
Ssofast evagreen supermix, by Bio-Rad (1 mentions)
69 protocols using purification kit
1
Characterization of HIV-1 Integrase Activity
2
IP3R2 Promoter Cloning and Reporter Assay
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from the various tissues using TRIzol reagent (Invitrogen Life Technologies) and purified with a purification kit (Qiagen). First-strand cDNA was synthesized from 2.5 μg of total RNA in a 20 μL reaction volume using 2 μL oligo(dT)18 primer (Takara) and 1 μL SuperScript® III Reverse Transcriptase (Invitrogen). RT-qPCR was carried out using a CFX96 Real-Time System (Bio-Rad) or StepOnePlus (Applied Biosystems), with the rice Ubiquitin gene used as an internal control. cDNA (30 × dilutions) was amplified using the SsoFast EvaGreen Supermix (Bio-Rad). The relative quantification method (2−ΔΔCT) was used to evaluate the quantitative variation of expression (relative to Ubiquitin expression), and each set of experiments were repeated independently three times54 (link).
4
CasRx Knockdown Mutant RNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To analyze the CasRx knockdown mutant sequence at the RNA level, total RNA from the cochleae and cDNA were obtained as described above. Target site sequences were amplified with primers TMC1-lib-F and TMC1-lib-R (Supplementary Table 2 ). PCR products were visualized on 2% agarose gels and purified with a purification kit (Qiagen). Paired-end reads (150 base pairs) were generated on an Illumina MiSeq platform. The reads from heterozygous samples were segregated based on the presence of the wild-type sequence (5′-ATG CCT CCT GGG GAT GTT CTG TCC CAC C-3′ and its reverse complement 5′-GGT GGG ACA GAA CAT CCC CAG GAG GGA CAT-3′) and the mutant sequence (5′-ATG TCC CTC CTG GGG AAG TTC TGT CCC ACC-3′) and its reverse complement 5′-GGT GGG ACA GAA CTT CCC CAG GAG GGA CAT-3′). The knockdown efficiency was calculated as (heoretical proportion – actual proportion)/theoretical proportion) × 100%.
5
Investigating Estrogen Receptor Signaling
6
Generation of pH-sensitive GluA2 Mutants
7
DNA Barcoding from Preserved Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA was extracted from preserved liver and muscle tissues (less than 50 mg) by DNeasy tissue kits (Qiagen, Switzerland) as per the manufacturer’s instructions. Quality of DNA was checked through agarose gel electrophoresis and concentration was measured using Thermo scientific NanoDrop One. DNA samples were brought to PC-2 lab at School of Animal and Veterinary Sciences, The University of Adelaide, Australia for DNA barcoding.
mtDNA fragment 16S rRNA was amplified using 16SA-L (5′-CGCCTGTTTATCAAAAACAT-3′) and 16SB-H (5′-CCGGTCTGAACTCAGATCACGT-3′) primer set (Vences et al. 2005 (link)). PCR amplification was carried out in 25 µl volume reaction with 2–5 µl of DNA. The PCR amplification comprised of 94 °C for 3 min; 40 cycles at 94 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min; and a final 10 min at 72 °C. The PCR products were checked on 1.2% agarose gels. Purification of PCR products was performed using the Qiagen purification kit and all the samples were sequenced in both directions using dideoxy chain termination direct Sanger sequencing on AB3730xl sequencer (AGRF, Australia) according to standard protocols.
mtDNA fragment 16S rRNA was amplified using 16SA-L (5′-CGCCTGTTTATCAAAAACAT-3′) and 16SB-H (5′-CCGGTCTGAACTCAGATCACGT-3′) primer set (Vences et al. 2005 (link)). PCR amplification was carried out in 25 µl volume reaction with 2–5 µl of DNA. The PCR amplification comprised of 94 °C for 3 min; 40 cycles at 94 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min; and a final 10 min at 72 °C. The PCR products were checked on 1.2% agarose gels. Purification of PCR products was performed using the Qiagen purification kit and all the samples were sequenced in both directions using dideoxy chain termination direct Sanger sequencing on AB3730xl sequencer (AGRF, Australia) according to standard protocols.
8
ChIP-PCR Analysis of Transcription Factor Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were cross-linked with 1% formaldehyde at room temperature for 10 min, washed twice with 10 ml ice-cold PBS, and then scraped into 0.5 ml of lysis buffer and left on ice for 10 min. Samples were treated according to the instructions of ChIP kit (Beyotime, Haimen, Jiangsu, China). Immunoprecipitations were performed overnight with GFI1 antibody (1–2 μg). Immune-complexes were captured by incubation with 40 μl protein A/G Sepharose. DNA extraction was performed using Qiagen Purification Kit. The samples were analysed by PCR using primers whose sequences are listed below.
STAT3 promoter-F: gggttagctgagcagtgacat
STAT3 promoter-R: aagctgataacgtgtagggct
PTGER2 promoter-F: gcgcattgtgtggtttggtt
PTGER2 promoter-R: acacagaagatcggggcaac
STAT3 promoter-F: gggttagctgagcagtgacat
STAT3 promoter-R: aagctgataacgtgtagggct
PTGER2 promoter-F: gcgcattgtgtggtttggtt
PTGER2 promoter-R: acacagaagatcggggcaac
9
Quantification of Thermogenic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from 3T3-L1 cells after treatment without or with rh-irisin or rosiglitazone at indicated time point using TRIzol reagent and purified by Qiagen purification kit as per manufacturer’s instruction. RNA was quantified by Nanodrop2000 and purity was checked by 260/280 ratio. One microgram of total RNA was used for cDNA synthesis. cDNA synthesis was performed by reverse transcriptase (RT) enzyme obtained from Takara biosciences. cDNA was diluted to 1:5 and 5 µl was used for semi quantitative or quantitative RT-PCR (qRT-PCR) using Sybr green kit obtained from the Bio-Rad. Relative fold change in UCP-1, PGC-1α and TMEM26 transcripts was calculated using ddCT method [12] (link). PGC-1α and betatrophin (ANGPTL8) was measured by semiquantitave RT-PCR. PCR product was separated on 1.5% agarose gel electrophoresis and stained with ethidium bromide. Captured image density was analysed by NIH-ImageJ software. The primers used for RT-PCR and qRT-PCR were listed in Table 1 .
Primer sequences for the qRT-PCR.
| Gene | Forward primer 5′ → 3′ | Reverse Primer 5′ → 3′ | |
|---|---|---|---|
| 1 | UCP1 | CAAAAACAGAAGGATTGCCGAAA | TCTTGGACTGAGTCGTAGAGG |
| 2 | PGC-1α | CCCTGCCATTGTTAAGACC | TGCTGCTGTTCCTGTTTTC |
| 3 | Betatrophin | CAGGATGCCACACAGGAGCTTC | TCAGCTGCACTTGTAGTCTC |
| 4 | Beta-actin | CGCCACCAGTTCGCCATGGA | TACAGCCCGGGGAGCATCGT |
| 5 | TMEM26 | TTCCTGTTGCATTCCCTGGTC | GCCGGAGAAAGCCATTTGT |
10
Purifying and Sequencing PCR Products
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR products were purified using the Purification Kit (Qiagen Inc., Valencia, CA, USA) following the manufacturer’s procedure. Approximately 1–10 ng of purified PCR products was amplified using each primer at 3.3 μM (forward or reverse) and 1 μL of Big Dye terminator kit (Life Technologies) in a program of 96°C for 1 min, 35 cycles of 96°C for 15 sec, the temperature of primer annealing for 15 sec and 60°C for 15 sec. The fragments were precipitated using ammonium acetate, resuspended in formamide HI-DI (Applied Biosystems, Thermo Fisher Scientific, Inc., Waltham, MA, USA) and analyzed in an ABI 3730 DNA (Applied Biosystems) automatic sequencer.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!