Pyromark gold q96 reagent

Manufactured by Qiagen

Sourced in Germany, Sweden

The PyroMark Gold Q96 Reagents are a collection of reagents designed for use with the PyroMark Q96 platform. The reagents enable the analysis of DNA sequences through a process known as pyrosequencing, which is a real-time sequencing method.

Automatically generated - may contain errors

Lab products found in correlation

Epitect bisulfite kit, by Qiagen (17 mentions) Pyromark pcr kit, by Qiagen (15 mentions) Pyromark q96 id system, by Qiagen (13 mentions) Pyromark q96 id, by Qiagen (10 mentions) Pyromark q96 vacuum workstation, by Qiagen (9 mentions) Streptavidin sepharose high performance bead, by GE Healthcare (7 mentions) Pyromark q96 id instrument, by Qiagen (7 mentions) Hotstartaq dna polymerase, by Qiagen (6 mentions) Ez dna methylation kit, by Zymo Research (5 mentions) Pyromark assay design software 2, by Qiagen (5 mentions) Pyromark q96, by Qiagen (5 mentions) Pyromark id system, by Qiagen (5 mentions) Streptavidin sepharose, by GE Healthcare (4 mentions) Pyromark q96 id instrument, by Biotage (4 mentions) Veriti thermal cycler, by Thermo Fisher Scientific (4 mentions) Streptavidin coated sepharose beads, by GE Healthcare (4 mentions) Vacuum prep workstation, by Biotage (4 mentions) Pyromark q24, by Qiagen (3 mentions) Hotstar taq pcr buffer, by Qiagen (3 mentions) Pyromark buffers, by Qiagen (3 mentions)

Close spelling variants of this product

PyroMark Q96 (70 citations) PyroMark Gold reagents (21 citations) PyroMark Gold Q96 Reagent Kit (18 citations) PyroMark Gold Q96 CDT reagent kit (14 citations) PyroMark Gold Q96 (9 citations) PyroMark Gold Q96 Reagents Kit (9 citations) PyroMark Gold Q96 CDT Reagents (9 citations) PyroMark reagents (7 citations) PyroMark Gold Q96 SQA Reagents (5 citations) PyroMark Q96 Reagents (3 citations)

82 protocols using pyromark gold q96 reagent

Validation of Somatic Mutations by Pyrosequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pyrosequencing technique was used for validation of specific discovered single base substitution-type mutations (NOTCH2 C7310T, SMYD1 G839T, MYD88 T794C, ZNF608 A3659G, PDE10A G1072A) in a validation cohort of 24 microdissected SMZL samples. An internal fragment of each gene was amplified by polymerase chain reaction (PCR) using primers specific for each gene and a PyroMark PCR kit (QIAGEN). The resulting PCR products were sequenced with the PyroMark Q24 (QIAGEN) pyrosequencer using PyroMark Gold Q96 reagents (QIAGEN) and sequencing primers specific for each gene.
Conventional Sanger sequencing was used to screen for mutations in two selected genes within the validation cohort (NOTCH2 and SMYD1). The PEST domain of NOTCH2 within exon 34 and all 10 exons of SMYD were sequenced in 8 validation and 2 WES cases. Primer sequences are given in Additional file 2: Table S2; Additional file 3: Table S3; Additional file 4: Table S4.

Peveling-Oberhag J., Wolters F., Döring C., Walter D., Sellmann L., Scholtysik R., Lucioni M., Schubach M., Paulli M., Biskup S., Zeuzem S., Küppers R, & Hansmann M.L. (2015). Whole exome sequencing of microdissected splenic marginal zone lymphoma: a study to discover novel tumor-specific mutations. BMC Cancer, 15, 773.

+ Open protocol

+ Expand

Quantifying DNA Methylation in T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA from ex vivo isolated or in vitro cultivated T cells, as well as other ex vivo isolated immune cell subsets was bisulfite converted by using the EZ DNA Methylation Kit (Zymo Research). Validated candidate regions from MS-HRM analysis were amplified by PCR containing 10 ng of bisulfite-converted genomic DNA, HotStar Taq PCR buffer (Qiagen), 1 U HotStar Taq DNA polymerase, 2.5 mM MgCl₂ and 0.38 μM each of forward and reverse primers (Supplementary Table S1) in a final volume of 50 μl (95°C for 15 min; 50 cycles: 95°C for 30 s, 57°C for 1 min, 72°C for 1 min; 72°C for 7 min). The PCR product was analyzed by gel electrophoresis. 20–40 μl of the PCR product, Pyromark Gold Q96 reagents (Qiagen), Pyromark buffers (Qiagen), Streptavidin Sepharose (GE Healthcare) and sequencing primers (Supplementary Table S1) were used for pyrosequencing on a PSQ96MA (Qiagen) according to the manufacturer's protocol. Significance of methylation rate differences between compared subsets was calculated using Prism (GraphPad Software) and a two-way ANOVA with Bonferroni's multiple comparisons test. Locations of analyzed CpG motifs in mouse genome GRC38m are listed in Supplementary Table S2.

Yang B.H., Floess S., Hagemann S., Deyneko I.V., Groebe L., Pezoldt J., Sparwasser T., Lochner M, & Huehn J. (2015). Development of a unique epigenetic signature during in vivo Th17 differentiation. Nucleic Acids Research, 43(3), 1537-1548.

+ Open protocol

+ Expand

Parental Allelic Expression Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Parental allelic expression quantification was performed by pyrosequencing. Streptavidin Sepharose High-Performance beads (GE healthcare) dissolved in binding buffer (10 mM Tris-HCL pH7.6, 2 M NaCl, 1 mM EDTA, 0.1% Tween-20) were shaken with the qPCR product at 1400 rpm for 20 min. The biotinylated strand was purified using a PyroMark Q96 Vacuum Workstation (QIAGEN) then sequencing primers annealed in annealing buffer (20 mM Tris-acetate pH7.6, 2 M magnesium acetate) at 85 °C for 3 min. Sequencing was performed on a PyroMark Q96 MD pyrosequencer (Qiagen) using PyroMark Gold Q96 Reagents (Qiagen). The mean expression bias from three or four biological replicates of tissue was then calculated. Genomic DNA was also assessed to identify any amplification bias from the primers and all assays were corrected for this bias.

Edwards C.A., Watkinson W.M., Telerman S.B., Hulsmann L.C., Hamilton R.S, & Ferguson-Smith A.C. (2023). Reassessment of weak parent-of-origin expression bias shows it rarely exists outside of known imprinted regions. eLife, 12, e83364.

+ Open protocol

+ Expand

Exon 7 Splicing Ratio Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The ratio of correctly vs. alternatively spliced exon 7 in the transfected cell lines with hepatic origin and human liver samples was analyzed using pyrosequencing. Spliced exon 7 from minigene experiments and from cDNA from human liver samples was amplified using primer pair 7 (minigene) and primer pair 8 (liver samples) listed in Supplementary table S1. Samples were prepared using PyroMark™ Binding and Annealing Buffer (QIAGEN) and the PyroMark™ Vacuum Prep Station (Biotage, Uppsala, Sweden). Pyrosequencing was carried out on the PyroMark™ Q96 ID (Pyrosequencing AB, Uppsala, Sweden) with PyroMark™ Gold Q96 reagents (QIAGEN) using the primer 9 (minigene) and primer 10 (liver samples).

Römer S., Meyer M.J., Klein K., Schneider L.V., Matthaei J., Tzvetkova A., Łapczuk-Romańska J., Gaedcke J., Droździk M., Brockmöller J., Nies A.T, & Tzvetkov M.V. (2021). Effects of a Common Eight Base Pairs Duplication at the Exon 7-Intron 7 Junction on Splicing, Expression, and Function of OCT1. Frontiers in Pharmacology, 12, 661480.

+ Open protocol

+ Expand

Quantitative DNA Methylation Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Purified genomic DNA from tissue samples was used for global long interspersed nucleotide element-1 (LINE-1) and miR-137 promoter methylation analyses. The procedure was in detail described in our previous reports^{36 (link),40 (link)}. Briefly, we applied Cells-to-CpG Bisulfite Conversion Kit (Life Technologies, Carlsbad, CA) for bisulphite modification, thereafter the standard PCR with biotin-labelled primers and eventually the pyrosequencing on PyroMark Q96 ID (Qiagen) using PyroMark Gold Q96 reagents (Qiagen). The mean methylation level of analysed CpG motifs was used for quantitative methylation analysis.

Boehm E.T., Thon C., Kupcinskas J., Steponaitiene R., Skieceviciene J., Canbay A., Malfertheiner P, & Link A. (2020). Fusobacterium nucleatum is associated with worse prognosis in Lauren’s diffuse type gastric cancer patients. Scientific Reports, 10, 16240.

+ Open protocol

+ Expand

Quantitative DNA Methylation Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from the same tissue samples pretreated with QIAzol Lysis reagent and chloroform according to the manufacturer's protocol (provided by QIAGEN). Purified genomic DNA was bisulfite modified using the Cells-to-CpGTM Bisulfite Conversion Kit (Life Technologies, Carlsbad, CA) following the manufacturer's protocol, as described previously (17 (link),18 (link)). Briefly, quantitative methylation analyses of long interspersed nucleotide element 1 (LINE-1) were performed by bisulfite pyrosequencing on PyroMark Q96 ID (QIAGEN) using PyroMark Gold Q96 reagents (QIAGEN). For further quantitative methylation analysis, we used the mean methylation level of analyzed CpG sites.

Petkevicius V., Thon C., Steponaitiene R., Skieceviciene J., Janciauskas D., Jechorek D., Malfertheiner P., Kupcinskas J, & Link A. (2022). Differential Expression of Long Noncoding RNA HOTAIR in Intestinal Metaplasia and Gastric Cancer. Clinical and Translational Gastroenterology, 13(5), e00483.

+ Open protocol

+ Expand

Bisulfite Conversion and Pyrosequencing Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bisulfite converted DNA was initially subjected to PCR amplification. Primers were purchased at Metabion and the sequences are provided in Supplementary Table S2, as described before^{17 (link)}. 20 µl PCR products were subsequently immobilized to 5 µl Streptavidin Sepharose High Performance Bead (GE Healthcare, Piscataway, NJ, USA), and were finally annealed to 1 µl sequencing primer (5 μM) for 2 min at 80 °C. Amplicons were sequenced using PyroMark Gold Q96 Reagents (Qiagen) on PyroMark Q96 ID System (Qiagen, Hilden, Germany) and analyzed with PyroMark Q CpG software (Qiagen). The relevant sequences are depicted for the five relevant genomic regions in Supplementary Fig. S4. The 15 CpG model for pyrosequencing data, which was trained by lasso regression with the lambda parameter chosen by cross-fold validation, has been described before^{17 (link)} and is provided in Supplementary Table S3.

Han Y., Nikolić M., Gobs M., Franzen J., de Haan G., Geiger H, & Wagner W. (2020). Targeted methods for epigenetic age predictions in mice. Scientific Reports, 10, 22439.

+ Open protocol

+ Expand

LINE-1 DNA Methylation Analysis

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bisulfite conversion of purified genomic DNA was performed using Cells-to-CpG™ Bisulfite Conversion Kit (Life Technologies) according to the manufacturer’s protocol. After PCR using biotin-labeled LINE-1 region primers, the success of reaction was verified in agarose gel (1%) electrophoresis and no-template controls. For quantitative methylation analyses we used bisulfite pyrosequencing of LINE-1, which was performed on PyroMark Q96 ID (QIAGEN) using PyroMark® Gold Q96 reagents (QIAGEN) according to manufacturer’s instructions. As previously described, we accessed LINE-1 X58075 103–249 bp region with mean of 4 CpG-sites^{38 (link), 39 (link)}. LINE-1 primers: forward TTTTGAGTTAGGTGTGGGATATA, reverse 5′-biotin-AAAATCAAAAAATTCCCTTTC and pyrosequencing AGTTAGGTGTGGGATATAGT. Briefly, biotin-labeled PCR products were first captured on streptavidin-coated magnetic beads and then underwent pyrosequencing procedure. Mean methylation level of 4 measured CpG sites was used for the further analyses. Samples with poor DNA quality and/or repeatedly insufficient bisulfite conversion were excluded from further analyses.

Kupcinskas J., Steponaitiene R., Langner C., Smailyte G., Skieceviciene J., Kupcinskas L., Malfertheiner P, & Link A. (2017). LINE-1 hypomethylation is not a common event in preneoplastic stages of gastric carcinogenesis. Scientific Reports, 7, 4828.

+ Open protocol

+ Expand

Bisulfite-based DNA Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA (0.5–1 µg) was bisulphite treated using the two-step protocol of the Imprint DNA Modification Kit (Sigma). The Dlk1 sDMR region was amplified from bisulphite converted DNA through PCR with HotStarTaq DNA Polymerase (Qiagen) (primer sequences provided below). PCR products were shaken at 1,400 rpm with Streptavidin Sepharose High Performance beads (GE healthcare) in binding buffer (10 mM Tris-HCl pH7.6, 2 M NaCl, 1 mM EDTA, 0.1% Tween-20) for 20 min. The biotinylated strand of the product was purified using the PyroMark Q96 Vacuum Workstation (Qiagen). The sequencing primer was annealed to the template in annealing buffer (20 mM Tris-acetate pH7.6, 2 M magnesium acetate) at 85 °C for 4 min. Sequencing was performed with the PyroMark Q96 MD pyrosequencer (Qiagen) using PyroMark Gold Q96 Reagents (Qiagen).

Van de Pette M., Dimond A., Galvão A.M., Millership S.J., To W., Prodani C., McNamara G., Bruno L., Sardini A., Webster Z., McGinty J., French P.M., Uren A.G., Castillo-Fernandez J., Watkinson W., Ferguson-Smith A.C., Merkenschlager M., John R.M., Kelsey G, & Fisher A.G. (2022). Epigenetic changes induced by in utero dietary challenge result in phenotypic variability in successive generations of mice. Nature Communications, 13, 2464.

+ Open protocol

+ Expand

Quantifying E-cadherin Promoter Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols

CpG methylation of the promoter region of the E‐cadherin gene was quantified by pyrosequencing. The EpiTect Bisulfite Kit (Qiagen, Germany) was used for bisulphite conversion of genomic DNA. The PyroMark Gold Q96 Reagents and the PyroMark Q96 ID instrument (Qiagen, Germany) were used for pyrosequencing according to the manufacturer's instructions. Seven total CpG sites were analysed per sample.
Pyro Q‐CPG (Biotage, SWEDEN) was used to analyse the methylation status of each Site. Pyrosequencing primers were designed using PYROMARK assay design software 2.0 (Qiagen, Germany). The primers for the analysis of E‐cadherin CPG regions were as follows (5′ biotin modification): FORWARD, 5′‐GGGTTGGGATTAGAATTTAGTGGAATTA‐3′; REVERSE, 5′‐ATTCACCTACCCACCACAACCAATCAACAA‐3′ and S, 5′‐ATTTTAGGTTAGAGGGTTAT‐3′.

Huang J., Fang J., Chen Q., Chen J, & Shen J. (2022). Epigenetic silencing of E‐cadherin gene induced by lncRNA MALAT‐1 in acute myeloid leukaemia. Journal of Clinical Laboratory Analysis, 36(8), e24556.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!