Cnbr activated sepharose 4b

For further purification of BSA-AFM₁ antibody, the antibody produced against AFM₁ was negatively selected by a BSA-Sepharose 4B affinity column. In order to prepare affinity medium, CNBr-activated Sepharose 4B (Amersham Pharmacia Biotech) was swelled in adequate 1 mM HCl for two hours. For each milliliter of the swelled resin, 5 mg of BSA in 0.1 M carbonate buffer, pH 8.5 containing 0.5 M NaCl was added and the mixture was stirred for 2 hours at RT. Residual active sites were blocked with 0.2 M glycine containing 0.5 M NaCl. The resin was washed thrice with alternate buffers (50 mM acetate buffer pH 4 and 50 mM carbonate buffer pH 9 containing 0.5 M NaCl), then loaded on to a column and equilibrated with phosphate buffered saline (PBS) pH 7.2. The purified IgG fraction at concentration of 5 mg/mL was applied to the column, and the column was washed with PBS till the absorbance of effluents reached zero at 280 nm. Finally, 3 column volumes of 0.1 M glycine with pH 2.7 were used to elute bound antibodies from the column.

To construct an SDR overexpression plasmid, a 730 nucleotide DNA fragment was amplified by PCR using LD44769 (the EST clone of the SDR 5’ region) as template DNA and Pfu polymerase (Agilent/Strategene) and the following two primers: 5’ CGGGATCCGTGGCAGATGTATC3’ and 5’GGAATTCTGCGA TAGTCGTGATTG3’. BamHI and EcoRI digested PCR product was then cloned into the pRSET A vector. The resulting plasmid was used to express and purify 39 kDa recombinant SDR protein, which was used for primary and booster injections into rats to raise rat anti-SDR polyclonal antibodies. Recombinant SDR was coupled to CNBr-activated sepharose 4B (Amersham Biosciences, NJ, USA), and serum taken from rats after the booster injection was applied to this column. Bound antibodies were eluted to recover affinity-purified rat anti-SDR antibodies. Affinity-purified antibody was tested for specificity and cross-reactivity with Drosophila InR protein, as follows. InR and SDR were overexpressed in neuroendocrine cells of fly larvae using the IRP-Gal4 system (IRP-Gal4>UAS-InR or IRP-Gal4>UAS-Sdr). Ectopic expression of SDR was detected in SDR-overexpressing larvae but no immunoreactivity was detected in InR-overexpressing larvae (i.e., IRP-Gal4>UAS-InR) (Fig. 2). Therefore, the rat anti-SDR antibody is specific for Drosophila SDR and does not cross-react with InR in Drosophila larvae.