Log In Sign up
The largest database of trusted experimental protocols

Lrrk2 shrna

Manufactured by Merck Group
Visit Supplier

LRRK2 shRNA is a laboratory research tool designed to provide targeted knockdown of the LRRK2 gene. It functions by using short hairpin RNA (shRNA) technology to suppress the expression of the LRRK2 gene in cell lines or model systems. The core function of this product is to facilitate the study of LRRK2 gene and its role in biological processes.

Automatically generated - may contain errors

Lab products found in correlation

Lenticrispr v2, by Addgene (1 mentions) Lenti x concentrator, by Takara Bio (1 mentions) Rab10, by Merck Group (1 mentions) Pspax2, by Addgene (1 mentions) X tremegene hp dna transfection reagent, by Roche (1 mentions)

Close spelling variants of this product

LRRK2

2 protocols using lrrk2 shrna

1

LRRK2 Knockdown in OVCAR8 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
LRRK2 shRNAs were purchased from Sigma: LRRK2 shRNA‐1: CGCAGCTTTCAGCGATTCTAA; LRRK2 shRNA‐2: TCCACTTTGCAGCGCTTTAAA. OVCAR8 Knockout cells were generated using CRISPR. Briefly, two LRRK2 sgRNAs, GAGTCCAAGACGATCAACAG and AACGCTGGTCCAAATCCTGG, were inserted into LentiCRISPRv2 (Addgene). Lentivirus was packaged, and cells were infected with the virus and selected with puromycin for 10 days to establish stable cell line.
Chen L., Hou J., Zeng X., Guo Q., Deng M., Kloeber J.A., Tu X., Zhao F., Wu Z., Huang J., Luo K., Kim W, & Lou Z. (2021). LRRK2 inhibition potentiates PARP inhibitor cytotoxicity through inhibiting homologous recombination‐mediated DNA double strand break repair. Clinical and Translational Medicine, 11(3), e341.
+ Open protocol
+ Expand
2

Lentiviral Vector Construction for Rab10 and LRRK2

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rab8, Rab10, and LRRK2 shRNA constructs were obtained from Sigma. Rab10 WT and T72E were cloned into the pER4 lentiviral expression vector using standard cloning techniques. Lentiviral vectors along with helper plasmids, pLP3 (Invitrogen) and psPAX2 (Addgene, #12260), were transfected into HEK-FT cells using X-treme Gene HP DNA Transfection Reagent (Roche). The resulting virus particles were purified and concentrated using LentiX-concentrator (Clontech). Virus titers were determined using the RETROtek p24 Antigen ELISA kit (ZeptoMetric Corporation). Concentrated virus was stored in single use aliquots at −80 °C.
Ysselstein D., Nguyen M., Young T.J., Severino A., Schwake M., Merchant K, & Krainc D. (2019). LRRK2 kinase activity regulates lysosomal glucocerebrosidase in neurons derived from Parkinson’s disease patients. Nature Communications, 10, 5570.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!