Pmscarlet c1

All cell lines used in this study are listed in Table EV1. All cell lines tested negatively for mycoplasma contamination. HAP1 cell lines were cultured in a humidified growth chamber at 37°C and 5% CO₂ in Iscove's Modified Dulbecco's Medium (IMDM; Sigma‐Aldrich) supplemented with 10% Fetal Bovine Serum (Thermo Fisher Scientific) and 1% (v/v) Penicillin–Streptomycin (Sigma‐Aldrich).
For mutation of the endogenous FBXW7 locus in HAP1 p53⁻ cells, a CRISPR/Cas9 strategy was applied. SgRNAs were cloned into pSpCas9(BB)‐2A‐GFP (PX458, Addgene plasmid #48138). For homologous recombination, a repair template carrying the respective mutation and 1,000 base pair (bp) homology flanks was synthesized as gBlock gene fragment (Integrated DNA Technologies IDT) and inserted into the plasmid pmScarlet_C1 (Addgene plasmid #85042). The plasmid mix of guide RNA plasmid and the repair template was transfected into HAP1 cells using FuGENE HD (Promega). Two days after transfection, cells were sorted for the presence of Cas9 (GFP positive) and repair template (mScarlet positive). Three days later, single cells were sorted into 96‐well plates. Clonal populations were expanded gradually over the course of 3 weeks. The FBXW7 mutations were identified by Sanger Sequencing, and karyotypes of the cell lines were validated by flow cytometry and whole‐genome sequencing.

The pUASTattB-lifeact::mScarletx2 was constructed as follows: A DNA fragment was amplified with KOD plus Neo (TOYOBO, Japan) using pmScarlet_C1 (Addgene, #85042) as the template, with the following primer pairs: For_SS#38 “AGGGGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGC” and Rev_SS#39 “GCCGCGGCCGCAGATCTACTTGTACAGCTCGTCCATGCCG”. The pUASTattB-lifeact::GFP11x3 plasmid^{52 (link)} was digested at AgeI and BglII sites then the fragment was fused using In-Fusion HD cloning Kit (Clontech), resulting in an intermediate construct pUASTattB-lifeact::mScarlet. Another DNA fragment was amplified using the same template with the primer pairs: For_SS#38 (same as above) and Rev_SS#40 “CATGGTGGCGACCGGACCTCCGCCCTTGTACAGCTCGTCCATGCCG”. The pUASTattB-lifeact::mScarlet was digested by AgeI site then the second fragment was fused to produce pUASTattB-lifeact::mScarletx2. The constructs were confirmed by sequencing.

We constructed all sensors by polymerase chain reaction (PCR) cloning. The template for the mScarlet moiety of the protein fusions originated from pmScarlet_C1 (#85042, Addgene). The template for the Troponin C (TnC) moieties originated from Twitch-2B (#100040, Addgene) and Twitch-3 (#49532, Addgene). The sfGFP, mNeon, mCitrine, mVenus, and mClover moieties of the fused proteins originated from sequences of msfGFP (# 91902, Addgene), mNeonGreen (#58179, Addgene), Twitch-3 (#49532, Addgene), Twitch-2B (#100040, Addgene), and mClover3 (#74252, Addgene), respectively. We added a nuclear-export sequence (MLQNELALKLAGLDINKTG)^{10 (link),56 (link)} at the N-terminus to localize the sensor expression to the cytoplasm. The sequences of all sensors are in Supplementary Table 2. To express the fused proteins in HEK293 cells, we inserted the genes into a lentivirus backbone under the CamkIIα promoter (#48762, Addgene). To express the fused proteins in cultured neurons and in live mice, we inserted the genes into an adeno-associated virus backbone under the CamkIIα promoter (#26969, Addgene). To express the fused protein in bacteria, we inserted the genes into the pET-28b backbone (69865-3, Millipore Sigma) while fusing the sensors to a 6× His tag.