Rq1 dnase stop solution

Total RNA was isolated from tobacco leaf tissues by using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). The RNA was digested by using RQ1 RNase-free DNase (Promega, Madison, WI, USA), and the DNase reaction was stopped by using the RQ1 DNase stop solution (Promega, Madison, WI, USA). The RNA was reverse-transcribed by using an oligo dT15 primer, dTNPs, RNasin Plus RNase inhibitor, and M-MLV reverse transcriptase, RNase (H-), Point Mutant (all from Promega, Madison, WI, USA). qRT-PCR was performed by using the Mx3005P system (Stratagene, Agilent, Waldbronn, Germany). Amplification reactions were performed by using ABsolute Blue SYBR Low Rox Mix (Thermo Scientific, Surrey, UK). For each target, different primer pairs were designed and tested for primer dimer formation and performance in a first qPCR run. Their efficiency was tested by plotting a standard curve with a five-fold dilution of cDNA. The ACTIN9 gene was used as the internal standard. The following qPCR primers were used in this study: ASN1-forward, tcacatatattccctcataacacac; ASN1-reverse, aagaagcatcccactctacagctt; ASN5-forward, atatcttccctcacaacactccaact; ASN5-reverse, ctaccggaaggatcaaggttgt.

RNA was extracted from approximately 30–50μl of fly heads using 3X volume TRI Reagent (Sigma-Aldrich, St. Louis, MO). 1/5 volume of 100% chloroform (Sigma-Aldrich) was added and incubated at room temperature for 10 minutes. Upper aqueous layer was recovered after spinning down at 13,000 rpm for 15 minutes. Same volume of 100% isopropanol was added and incubated at −20°C overnight to precipitate RNA. After spinning down, RNA pellet was washed with 200μl 70% ethanol once, resuspended in 20μl 1X RQ1 buffer (Promega, Madison, WI), and treated with 2μl RQ1 DNase (Promega) at 37°C for 30 minutes prior to the incubation with 2μl RQ1 DNase stop solution (Promega) at 65°C for 10 minutes. cDNA was generated from equal amount of RNA for each sample using Superscript IV (Thermo Fisher Scientific, Waltham, MA). Real-time PCR was performed using SsoAdvanced SYBR green supermix (Bio-Rad, Hercules, CA) in a CFX96 or CFX384 (Bio-Rad). Three technical replicates were performed for each of three biological qPCR replicates.
To confirm expression of clk isoforms, RNA was extracted as above. cDNA was generated using gene-specific primer clk(698R). PCR was then performed using clk(1F) and clk(101R) prior to resolving PCR products in 2% TBE gel. Bands were excised, and gel extracted for Sanger sequencing. Sequences for all primers are presented in Table S5.

Total RNA was isolated from A. thaliana seedlings using the GeneJet Plant RNA Purification Mini Kit (Thermo Fisher Scientific), following the manufacturer’s instructions.
The purified total RNA was treated with RQ1 RNAse-free DNAse (Promega, Southampton, UK) at 37 °C for one hour and the reaction terminated with RQ1 DNAse Stop Solution by incubation at 65 °C. The DNAse-treated RNA was divided into two halves. One half was subjected to cDNA synthesis using SensiFAST cDNA Synthesis Kit (Bioline). The other half of the DNAse-treated RNA was used as a minus-RT control for genomic DNA contamination. Both the plus RT and the minus RT were treated with RNAse H (New England Biolabs, Hitchin, UK) at 37 °C for 20 min and inactivated at 65 °C for 20 min. All samples were finally diluted 10× in nuclease-free water.

Residual genomic DNA was digested with RQ1 RNase-free DNase (Promega, Madison, WI) for 30 min at 37 °C. The reaction was stopped applying RQ1 DNase stop solution (Promega) for 10 min at 70 °C. cDNA was synthesized with random hexamer primers (Life Technologies) and RevertAid^TM Premium Reverse Transcriptase (Thermo Scientific, Waltham, MA) for 10 min at 25 °C, 50 min at 42 °C and 10 min at 70 °C and stored at −20 °C.