Rotor gene real time pcr detection system

The total RNA was extracted from WT and akirin2 KO HL60 cells and used to characterize the mRNA levels of selected Akirin2 IPs by qRT-PCR using gene-specific oligonucleotide forward (F) and reverse (R) primers (akirin2, F: 5′-CGGAGCCACTCTGAAAAGGA-3′, R: 5′-GAGATACTTCTGCGGCGAGG-3′; akirin1, F: 5′-CCCTCCGACAAGTTGGCATA-3′, R: 5′-TAGCTTGTTGGCCTTGTCCC-3′; rnf10, F: 5′-GCTGGAGTATCTGTCTGCCT-3′, R: 5′-TCAGTGCAAATGGTCCCCTC-3′; thrap5/med16, F: 5′-CTGACCCGCATGATCCACAT-3′, R:5′-CTATTAGCCAGGTGGTCCGC-3′) and the Kapa SYBR Fast One-Step qRT-PCR Kit (Sigma–Aldrich, St. Louis, MO, U.S.A.) and the Rotor-Gene Real-Time PCR Detection System (Qiagen). A dissociation curve was run at the end of the reaction to ensure that only one amplicon was formed and that the amplicons denatured consistently in the same temperature range for every sample. The mRNA levels were normalized against human β-actin (F: 5′-CTCGCCTTTGCCGATCC-3′; R: 5′-CGCCCACATAGGAATCCTTC-3′) using the genNorm ΔΔ-Ct (ddCt) method as previously described [31 (link)]. Normalized C_t values were compared between test WT and akirin2-KO HL60 cells by Student’s t test with unequal variance (P<0.05; n=3 biological replicates).

A real-time qRT-PCR was performed on RNA samples using gene-specific oligonucleotide forward (F) and reverse (R) 5′–3′ primers (P21F: CAACAGCATGCCTAGCAGAA and P21R: TCCATGCTTACAACCACCAA, P30F: ATTTCCGCATTTGACTACGC and P30R: GGCCAATTTCTTGGATCTGA, P33F: GTAACATTGCCTGGCCTCAT and P33R: TTCCAAGAGCTCGAACAGGT, P37F: TGCCGGTCAATTTCCATTAT and P37R: CATGTTTGCCTCGGAAGAAT, P14F: GCGAATCACGGAGTGGTACT and P14R: CCATGGAAACCCAATTTTTG), the Kapa SYBR Fast One-Step qRT-PCR Kit (Kapa Biosystems, Wilmington, MA, USA), and the Rotor-Gene Real-Time PCR Detection System (Qiagen Inc. Valencia, CA, USA). A dissociation curve was run at the end of the reaction to ensure that only one amplicon was formed and that the amplicons denatured consistently at the same temperature range for every sample. The mRNA levels were normalized against elongation factor 1 α (EF1α) as described previously [29 (link)] using the genNorm method (ddCT method as implemented by Bio-Rad iQ5 Standard Edition, Version 2.0) [30 (link)]. Normalized Ct values were compared between unfed and fed lice by Student’s t-test with unequal variance (p = 0.05; n = 3 biological replicates).

Total RNA was extracted from ISE6 tick cell cultures using TriReagent (Sigma-Aldrich) following manufacturer's recommendations. The expression of selected I. scapularis ISCW005600 and AAY66632 genes was characterized using total RNA extracted from infected and uninfected ISE6 tick cells. Real-time RT-PCR was performed on RNA samples using gene-specific oligonucleotide primers (Table 1) and the Kapa SYBR Fast One-Step qRT-PCR Kit (Kapa Biosystems, Wilmington, MA, USA) and the Rotor-Gene Real-Time PCR Detection System (Qiagen, Madrid, Spain). A dissociation curve was run at the end of the reaction to ensure that only one amplicon was formed and that the amplicons denatured consistently at the same temperature range for every sample. The mRNA levels were normalized against tick rpS4 using the genNorm method (Delta-Delta-Ct, ddCT) as described previously (Ayllón et al., 2015 (link)). Normalized Ct-values were compared between infected and uninfected tick cells by Student's t-test with unequal variance (P = 0.05; N = 4 biological replicates).