Taq dna polymerase kit

An actively-degrading methanogenic naphthalene enrichment culture was subsampled (4 mL) and extracted for genomic DNA using a commercial kit (FastDNA SPIN Kit for Soils, MP Biomedicals, Solon, OH, USA) according to the manufacturer’s procedure. PCR-based targeted gene surveys assays of the extracted DNA were performed to search for putative anaerobic naphthalene degradation genes, summarized in Table S1. PCR reactions (50 µL) were prepared using the Taq DNA Polymerase kit (Qiagen, Toronto, ON, Canada) and contained 2 µL of template DNA (0.2 ng/µL). 16S rRNA gene sequencing (by 454 pyrotag sequencing) of extracted genomic DNA was carried out using an established two-step PCR method targeting the V6-V8 regions of the 16S rRNA gene [22 (link)]. Purified amplicons of expected size were sequenced using a GS FLX Titanium Series Kit XLR70 (Roche Diagnostics Corporation, Indianapolis, IN, USA), and data analysis was conducted in Phoenix 2 as previously described [22 (link)]. Pyrosequencing reads are available within NCBI’s Short Read Archive (SRA) under BioProject PRJNA478574.

Total RNA was isolated from 1, 2 and 3 dpf medaka embryos using Trizol® (Invitrogen, Darmstadt, Germany). First strand cDNA was prepared according to the manufacturer's protocol (Invitrogen SuperScript®III First-Strand kit, Darmstadt, Germany). To clone both medaka full-length Wnt8a genes from the synthesized cDNA, PCR was performed using the Taq DNA polymerase kit (QIAGEN, Hilden, Germany) with the following primers.
Wnt8a1 forward 5′ AGCGTGGAGGGAGGCTGCAT 3′, Wnt8a1 reverse 5′ TGGAGTGCCCCGTGTTCTGT 3′, Wnt8a2 forward.
5′ AGGAAAATTGAAGAAGCGAACCAGGA 3′ and Wnt8a2 reverse.
5′ AGCCGTAATCTTTCATCTGGGGGC 3′. PCR program: Denaturation for 30 sec at 95°C, annealing for 30 sec at 70°C for Wnt8a1 and 62°C for Wnt8a2 followed by extension for 1 min at 72°C for a total of 35 cycles. The first cycle was preceded with initial denaturation for 3 min at 95°C and the last cycle was followed by additional extension for 3 min at 72°C and cooling at 25°C for 30 sec. The purified full-length Wnt8a cDNAs (Wnt8a1: 1349 bp and Wnt8a2: 1110 bp) were cloned into the pCRII-TOPO vector (Invitrogen, Darmstadt, Germany) according to the manufacturer's instructions and sequenced.

All PCR reactions were performed using GoTaq® 2× Colorless Master Mix (Promega) as per the manufacturer’s instructions with 50 ng DNA per reaction. MYF5 reactions contained 20% Q-solution (from QIAGEN Taq DNA Polymerase kit). MYOD1 reactions were supplemented with 5% DMSO. Primer sequences and thermocycling conditions are listed in Additional file 2. PCR amplicons were analyzed on a 1% agarose gel to confirm size and specificity. Amplicon purification and bidirectional Sanger sequencing were performed at the Australian Genome Research Facility, Perth.

To validate the variant found in ACTR3B, primer pairs for Sanger sequencing were designed with Geneious Prime (Dotmatics, San Diego, CA, USA), a platform utilizing the widely used Primer3 algorithm. The resulting forward- (ACTR3B-F: TACTCTCAGGAGGCTCCACC) and reverse-primer (ACTR3B-R: CCAGGGAGAGTGTGAAGCTG) were produced by metabion international AG (Steinkirchen, Germany). PCR was then performed using the Taq DNA Polymerase Kit (Qiagen, Santa Clarita, CA, USA) with a final volume of 40 µL containing 0.4 µL of Taq DNA Polymerase, 0.8 µL dNTPs, 4 µL QIAGEN PCR Buffer, 8 µL Q-Solution, 21.6 µL Ampuwa^® (Fresenius, Bad Homburg, Germany), 2 µL genomic DNA (c = 36 ng/µL (blood samples); 110 ng/µL (tissue sample)) and 1.6 µL of each primer (10 µM). The resulting PCR amplicons were purified using the QIAquick^® PCR Purification Kit (Qiagen, Santa Clarita, CA, USA) and later sequenced with the DCTS Quick Start Kit and CEQ™ 8000 Genetic Analysis System both by Beckman Coulter Inc. (Brea, CA, USA). All procedures were performed according to the manufacturer’s manual.

Fragments of five genes—cytochrome c oxidase I (COI), cytochrome b, elongation factor 1-alpha, 16S ribosomal RNA, and 28S ribosomal RNA—were amplified using the QIAGEN Taq DNA Polymerase Kit (details in SI Appendix, Table S15). The PCR product was purified by ExoSAP and sequenced in both directions on an Applied Biosystems 3730xl sequencer at Macrogen, Inc. Sequence chromatograms were aligned using the ClustalW algorithm (91 (link)) to create consensus sequences for each individual. These were visually checked for indels and translated to amino acids to check for stop codons. Due to the presence of indels, the ribosomal genes 16S and 28S were aligned using the G-INS-i algorithm (an iterative refinement method) in MAFFT, with ambiguously aligned regions deleted using Gblocks v.0.91 and the options set for a less stringent selection. We “RY-coded” purines and pyrimidines for the third codon of COI (see ref. 92 (link)) to ameliorate substitution saturation (SI Appendix, Table S16 and Fig. S15). The raw sequences for each gene are deposited in GenBank (SI Appendix, Table S13).

Heminested RT-PCR was performed as previously described [22 (link)] using the OneStep RT-PCR Kit. Briefly, for the first round 3 μL of extracted RNA was amplified in the RT-PCR mix prepared according to manufacturer's instructions, supplemented with 0.6 μM of each primer (JW12-F, JW6AS1-R1, and JW6AS2-R1; Table 2) and 5 U RNase inhibitor (RNasin Plus, 40 U/μL; Promega, Madison, USA), with the following cycling conditions: 50°C for 30 min and 95° for 15 min for reverse transcription and subsequent activation of the polymerase, followed by 10 cycles of 95°C for 20 s, 60°C for 30 s (1°C decrease/cycle), followed by 72°C for 30 s and 35 cycles of 95°C for 20 s, 52°C for 30 s, followed by 72°C for 30 s. For the second round, the Taq DNA Polymerase Kit (QIAGEN, Germantown, USA) was used with 2 μL of the first round product, 2.5 μL 10x PCR buffer, 1.2 mM final dNTP concentration (Invitrogen, Foster City, USA), 0.4 μM of heminested primers (JW12-F, JW10AS1-R2, and JW10AS2-R2; Table 2), 0.5 U of Taq DNA polymerase, and 19.35 μL Nuclease Free Water (Ambion, Foster City, USA). Cycling conditions were as follows: 95°C for 5 min followed by 35 cycles of 94°C for 20 s, 52°C for 20 s, followed by 72°C for 30 s. Amplifications were performed in a 2720 Thermal Cycler. Internal controls using GAPDH primers, as described in the one-round PCR, were run in parallel in the first round.

Total RNA was isolated from cell lines using the RNeasy Mini Kit (Qiagen). First strand cDNA was synthesized using 2 µg RNA and SuperScript II reverse transcriptase (Invitrogen), according to the manufacturer’s recommendations. PCR was performed over 30 cycles, using the Taq DNA polymerase kit (Qiagen) with primers listed in Table S11.