Preparation of adhesive ligands: the previously described Promega Pinpoint vector containing the sequence for a fragment spanning the 7th to 10th type III repeat of human FN (FN7–10) was cut with NruI and ligated to yield an expression vector for a fragment spanning the 9th to 10th type III repeat of human FN (FN9–10). The synergy-site mutant PHSAN [FN9–10(PHSAN)] was generated using the Stratagene QuikChange Site-Directed Mutagenesis kit and primers 5′-GGGTGCCCCACTCTGCGAATTCCATCACCC-3′ (forward) and 5′-GGGTGATGGAATTCGCAGAGTGGGGCACCC-3′ (reverse). Constructs were verified by DNA sequencing. Proteins were expressed in JM109 cells (Promega) in the presence of d -biotin and purified by affinity chromatography. Protein concentration and purity were confirmed by Western blotting and Coomassie blue staining.
Jm109 cells
Manufactured by Promega
Sourced in United States
The JM109 cells are a strain of Escherichia coli bacteria commonly used in molecular biology and genetic engineering applications. They are a competent cell line, meaning they can efficiently take up and incorporate foreign DNA into their genome. The JM109 cells provide a reliable and efficient tool for cloning, expression, and propagation of recombinant plasmids.
Automatically generated - may contain errors
Lab products found in correlation
Miniprep kit, by Qiagen (2 mentions)
Miraclean kit, by Mirus Bio (2 mentions)
Pcdna3, by Thermo Fisher Scientific (2 mentions)
Q5 dna polymerase, by New England Biolabs (1 mentions)
E coli atcc 25922, by American Type Culture Collection (1 mentions)
Pgem t vector, by Promega (1 mentions)
Genejet plasmid miniprep kit, by Thermo Fisher Scientific (1 mentions)
Pmirglo dual luciferase plasmid, by Promega (1 mentions)
Xhoi and xbai restriction enzymes, by New England Biolabs (1 mentions)
Applied biosystems 3730 dna analyzer, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Taq polymerase, by Thermo Fisher Scientific (1 mentions)
Qiaquick gel extraction kit, by Qiagen (1 mentions)
Lasergene version 10, by DNASTAR (1 mentions)
Pcr2.1 topo vector, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator v3.0 polymerization kit, by Thermo Fisher Scientific (1 mentions)
Platinum taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Glutathione sepharose 4b, by Cytiva (1 mentions)
11 protocols using jm109 cells
1
Preparation of FN9-10 Adhesive Ligands
2
Alu Deletion from MIR205HG/LEADR Transcript
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Deletion of Alu portion from MIR205HG/LEADR RefSeq transcript was obtained through site-directed mutagenesis by PCR, as described in ref. 58 (link). MIR205HG/LEADR vector, previously used to transform Dam-positive in bacteria, was amplified using high fidelity DNA Polymerase Q5 (New England Biolabs, Ipswich, MA, USA), in the presence of the deletion primers listed in Supplementary Table 7 . Dpn I restriction enzyme digestion was used to eliminate the wild type methylated vector, whereas remaining products were used to transform competent JM109 cells (Promega, Fitchburg, WI, USA). Colonies were then Sanger-sequenced to check for successful deletion.
3
Murine Chitinase-like Proteins Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full-length-coding region of murine Chil1, Chil3 and Chil4 were amplified using a mouse lung cDNA template. The cDNA fragments were directionally cloned into pcDNA3.1 (Invitrogen) to generate plasmids encoding V5/His tagged CLPs. TOP10 competent cells were transformed with CLP plasmids or pcDNA3.1 and sequence confirmed. Plasmids were routinely grown in transformed using JM109 cells (Promega) and plasmids isolated with miniprep kits (Qiagen) before undergoing endotoxin removal (MiraCLEAN Kit, Mirus) and plasmid concentration. DNA concentration was quantified by fluorometric methods (Qubit, Life Technologies).
4
Bacterial Strain Characterization and Cultivation
Check if the same lab product or an alternative is used in the 5 most similar protocols
A. baumannii clinical isolate strain Ci79 was used in all experiments unless otherwise stated. Plasmids were cloned into either Escherichia coli competent JM109 cells (Promega, Madison, WI) for heat shock transformation or Top10 cells for electroporation. Other assays utilized E. coli ATCC 25922 or Pseudomonas aeruginosa ATCC 27317 (American Type Culture Collection, Manassas, VA). Bacteria were grown at 37°C to desired concentrations based on optical density of broth cultures measured at 600 nm (OD600).
+ Expand
5
Editing the VACV Genome using CRISPR-Cas9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pCMV-Cas9 vector expressing the Streptococcus pyogenes Cas9 protein was purchased from Sigma-Aldrich. The nuclear localization signal (NLS) sequence (PKKKRKV) fused to the C-terminal extremity of Cas9 was removed by PCR-directed mutagenesis of pCMV-Cas9 using primers described in Table 1 .
The pU6-gRNA plasmids encoding guide RNAs targeting the E9L gene (Table 2 ) were obtained from Sigma-Aldrich. To avoid off-target cleavage in the VACV genome, gRNA sequences were submitted to the Cas-OFFinder algorithm [15 (link)]. pCMV-Cas9ΔNLS and pU6-gRNA were amplified in DH5 α E. coli.
The VACV (Copenhagen strain) E9L gene was cloned into the pGEM-T vector (Promega, Charbonnières, France) with primers described inTable 1 . The various mutations introduced into the E9L gene were generated by PCR-based site-directed mutagenesis (Table 1 ). pGEM-T-E9L constructs were amplified in JM109 cells (Promega).
The pU6-gRNA plasmids encoding guide RNAs targeting the E9L gene (
The VACV (Copenhagen strain) E9L gene was cloned into the pGEM-T vector (Promega, Charbonnières, France) with primers described in
6
PD1 3' UTR Cloning and Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3’ UTR of PD1 was amplified from wild-type c57BL/6 lymphocyte cDNA using PCR with 10 μM PD1 3’ UTR forward and reverse primer:
Forward: 5’-ATATACTCGAGCCAGATTCTTCAGCCATTAGCATGCT
Reverse: 5’-GCGTGTCTAGATTTAAAGCTTTTGGTACCATTTAATTATAACGGGCT and Taq polymerase (Invitrogen). The amplified cDNA was separated on a 1.5% agarose gel and the QIAquick Gel Extraction Kit (Qiagen) was used to isolate the PD1 3’ UTR cDNA. The PD1 3’ UTR and pmirGLO Dual Luciferase Plasmid (Promega, USA) were cleaved with XhoI and XbaI restriction enzymes (New England Biolabs, Ipswich, MA) and allowed to ligate overnight at 16° C. The PD1 3’ UTR pmirGLO Dual Luciferase Plasmid was amplified in JM109 cells (Promega, Madison, WI) and extracted using the GeneJET Plasmid Miniprep Kit (Fermentas, Burlington, ON). The concentration of the plasmid was then measured using a NanoDrop ND-1000. Sequencing for confirmation of successfully ligation was done using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) in an Applied Biosystems 3730 DNA Analyzer (Applied Biosystems).
Forward: 5’-ATATACTCGAGCCAGATTCTTCAGCCATTAGCATGCT
Reverse: 5’-GCGTGTCTAGATTTAAAGCTTTTGGTACCATTTAATTATAACGGGCT and Taq polymerase (Invitrogen). The amplified cDNA was separated on a 1.5% agarose gel and the QIAquick Gel Extraction Kit (Qiagen) was used to isolate the PD1 3’ UTR cDNA. The PD1 3’ UTR and pmirGLO Dual Luciferase Plasmid (Promega, USA) were cleaved with XhoI and XbaI restriction enzymes (New England Biolabs, Ipswich, MA) and allowed to ligate overnight at 16° C. The PD1 3’ UTR pmirGLO Dual Luciferase Plasmid was amplified in JM109 cells (Promega, Madison, WI) and extracted using the GeneJET Plasmid Miniprep Kit (Fermentas, Burlington, ON). The concentration of the plasmid was then measured using a NanoDrop ND-1000. Sequencing for confirmation of successfully ligation was done using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) in an Applied Biosystems 3730 DNA Analyzer (Applied Biosystems).
7
Cloning and Sequencing of PCR Amplicons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR amplicons were cloned into the pCR2.1-TOPO vector according to the protocol of the supplier (Thermo Scientific, Waltham, MA, USA). JM109 cells (Promega, Corp., Madison, WI, USA) were transformed and plated on LB/ampicillin agar for 16 h at 37 °C. Selected colonies were grown in LB/amp overnight at 37 °C. The plasmids were isolated using the PureYield plasmid mini preps system (Promega), tested for the inserts by digestion with Eco RI and sequenced using BigDye terminator kit V.3.1. (Applied Biosystems, Foster City, CA, USA). Sequences were analyzed using LaserGene Version 10 (DNASTAR, Inc., Madison, WI, USA) and Geneious package software (Biomatters Ltd., Auckland, New Zealand).
8
Calreticulin-related Molecule Identification in Leech
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The analysis of Hirudo medicinalis genome allowed in silico prediction of mRNA databases according to intro-exon boundaries. Based on the candidate sequence detected, forward and reverse primers were designed to frame the complete sequence of predicted mRNA. From total RNA extracted from leech nerve cord using TRIzol® reagent and according to the manufacturer’s procedure (Invitrogen, USA), cDNA were synthesized using an oligo(dT) priming. The calreticulin-related molecule was amplified by PCR using the specific forward (5′GGTAGCAATACGTGCAGTTTG3′) and reverse (5′GCAACCAAGAGTAGGCAACC3′) primers and the Platinum®Taq DNA Polymerase according to the manufacturer’s instructions (Invitrogen, USA). Selected PCR products were ligated into pGEM T-easy vector and cloned into JM109 cells according to the manufacturer’s instructions (Promega, USA). Finally, products were sequenced using BigDye Terminator v3.0 polymerization kit before detection on Genetic Analyzer (Applied Biosystems, USA). BLAST programs were used for sequence analysis in databases and comparison with initial predicted mRNA sequence [27 (link),28 (link)]. Phylogenetic analysis was carried out by Geneious® Basic v5.6 software [29 (link)].
9
Purification of Recombinant Human α-Enolase
Check if the same lab product or an alternative is used in the 5 most similar protocols
We obtained sequence encoding full-length human α-enolase (433 amino acids; GenBank AK315417, Ensembl: ENSG00000074800). As a result of post-translational modification, human α-enolase is a 47-kDa glycoprotein. Complementary DNA (cDNA) cloning and production of fusion proteins were described elsewhere [20 (link)]. Briefly, full-length and truncated cDNA encoding human α-enolase was amplified in polymerase chain reactions, and ligated to sequence encoding glutamine S-transferase (GST) (GE Healthcare Bio-Sciences Corp., Piscataway, NJ). DNA was cloned into pGEX plasmids and transformed into JM109 cells (Promega, USA), and protein expression was induced using isopropyl-β-d -thiogalactopyranoside. After protein extraction from JM109 cells, tagged proteins were affinity purified using glutathione-Sepharose 4B (Amersham Pharmacia Biotech).
+ Expand
We obtained sequence encoding full-length human α-enolase (433 amino acids; GenBank AK315417, Ensembl: ENSG00000074800). As a result of post-translational modification, human α-enolase is a 47-kDa glycoprotein. Complementary DNA (cDNA) cloning and production of fusion proteins were described elsewhere [20 (link)]. Briefly, full-length and truncated cDNA encoding human α-enolase was amplified in polymerase chain reactions, and ligated to sequence encoding glutamine S-transferase (GST) (GE Healthcare Bio-Sciences Corp., Piscataway, NJ). DNA was cloned into pGEX plasmids and transformed into JM109 cells (Promega, USA), and protein expression was induced using isopropyl-β-
10
Murine Chitinase-like Proteins Cloning
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!