Peiz hiv zsgreen lentivirus vector

The sequence of the full‐length coding region of the S100A10 mRNA (NM_002966.2 (GenBank)) was amplified by PCR and cloned into the pEIZ‐HIV‐ZsGreen lentivirus vector (Addgene: #18121).⁷ The shRNA sequences encoding for the S100A10 shRNA constructs (shS100A10) were cloned between the BamHI and EcoRI sites of the miRZIP vector (System Biosciences) and sequenced. The following target sequences were used: shS100A10‐1, CCATGATGTTTACATTTCACA; shS100A10‐5, GACCAGTGTAGAGATGGCAAA. A negative control was purchased from System Biosciences. Lentiviruses were produced as previously described.²² The culture supernatant containing lentivirus was collected and concentrated by LentiX concentrator (Clontech) and was resuspended in phosphate‐buffered saline. Breast cancer cells constitutively expressing S100A10 shRNA constructs were established by infecting cells with lentivirus constructs at a multiplicity of infection (MOI) of 5 (breast cancer cell line) or of 30 (breast cancer PDX cells). Infected cells were purified based on puromycin resistance (1 µg/mL) or their ZsGreen expression.