Dnase stop solution

Manufactured by Promega

Sourced in United States

The DNase stop solution is a laboratory product designed to halt the activity of DNase enzymes. It functions by effectively terminating the catalytic action of DNase, thereby preserving the integrity of DNA samples. The solution is intended for use in molecular biology applications where the controlled inhibition of DNase is required.

Automatically generated - may contain errors

Lab products found in correlation

12 protocols using dnase stop solution

Exosomal DNA Isolation from Neuroblastoma Plasma

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

We isolated exosomes from nineteen plasma NB samples collected at onset of disease and, for four patients, at the time of relapse too, as previously described [19 (link)]. Exosomes were isolated with the specific Exo-RNeasy serum/plasma Midi Kit (QIAGEN). The exosomes were incubated in 200 µL PBS with 1 µL DNase I (1 unit/µL) (Promega, Madison, WI, USA) at 37 °C for 30 min. Then, 5 µL of DNase stop solution (Promega) was added, and the exosomes were heated at 65 °C for 5 min. Following, the exosomes were washed and resuspended in 200 µL PBS [41 (link)]. Exosomes were lysed with Triton X-100 (2%), SDS (0.1%) and Buffer AL (QIAGEN) as described by Vagner et al. [42 (link)]. Finally, the exo-DNA was extracted using the QIAamp MinElute ccfDNA Mini Kit (QIAGEN). Exo-DNA quantity and quality were assessed with 1× dsDNA HS assay on Qubit 4.0 fluorometer (ThermoFisher, Waltham, MA, USA) and with high sensitivity DNA assay on Agilent Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), respectively.

Degli Esposti C., Iadarola B., Maestri S., Beltrami C., Lavezzari D., Morini M., De Marco P., Erminio G., Garaventa A., Zara F., Delledonne M., Ognibene M, & Pezzolo A. (2021). Exosomes from Plasma of Neuroblastoma Patients Contain Doublestranded DNA Reflecting the Mutational Status of Parental Tumor Cells. International Journal of Molecular Sciences, 22(7), 3667.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For Fig S3D, total RNA was extracted from cells using QIAshredder and RNeasy kits (QIAGEN). To remove any DNA, the extracts were incubated with DNAse buffer (Promega) and residual DNAse was subsequently inactivated with DNAse stop solution (Promega). cDNA synthesis was performed using LunaScript RT SuperMix Kit (NEB). Polymerase chain reactions were carried out using TaqMan 2X Universal PCR Master Mix or SYBR Green PCR Master Mix (Thermo Fisher Scientific) on a QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific). Acidic ribosomal phosphoprotein P0 (36B4), β-actin (b-act), and 18S ribosomal RNA (18 s) were used as internal controls. The following primer sets were used: 36B4_F; AGATGCAGCAGATCCGCAT and 36B4_R; GTTCTTGCCCATCAGCACC, b-act_F; GCTCTGGCTCCTAGCACCAT and b-act_R; GCCACCGATCCACACAGAGT, and 18s_F; CGGCTACCACATCCAAGGAA and 18s_R; GCTGGAATTACCGCGGCT, with the corresponding 18s TaqMan probe GAGGGCAAGTCTGGTGCCAG. The TaqMan gene expression assay (premixed primer set and probes) was used for mouse Bcl9l (Mm01143422_m1).

Diaz-Vegas A., Norris D.M., Jall-Rogg S., Cooke K.C., Conway O.J., Shun-Shion A.S., Duan X., Potter M., van Gerwen J., Baird H.J., Humphrey S.J., James D.E., Fazakerley D.J, & Burchfield J.G. (2022). A high-content endogenous GLUT4 trafficking assay reveals new aspects of adipocyte biology. Life Science Alliance, 6(1), e202201585.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis of Mouse Colon Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

For mice samples, approximately 2 cm of the colon was isolated, supplemented with Trifast peqGOLD (Peqlab), and homogenized with an electrical tissue homogenizer. After centrifugation, an equal volume of 70% ethanol was added to the supernatant and RNA was extracted using the QIAGEN RN easy kit, following the manufacturer’s instructions. Prior to cDNA synthesis, DNase I was added to the isolated RNA (30 min at 37 °C). Next, DNase stop solution (Promega) containing EDTA (10 min at 65 °C) and random primers were added (1 µl) (5 min at 70 °C). cDNA synthesis reactions (10 µl) were prepared of 4 µL 5× MLVRT buffer (Promega), 2 µl dNTPs and 1 µl reverse transcriptase (MLVRT; Promega). Samples were incubated 10 min at 25 °C followed by 60 min incubation at 42 °C. The qPCR reactions (20 µl) consisted of 10 µl 2× GoTaq® qPCR Master Mix (Promega), 0.5 mM reverse and forward primers, and 2 µl cDNA. The qPCR was performed according to the manufacturer’s protocol on the StepOnePlus™ Real-Time PCR system (Applied Biosystems). Gapdh and β-Actin were used as reference genes for relative quantification according to the Litvak method (ΔΔCt). Primers were designed using the Primer3 open software (http://primer3.ut.ee) upon NCBI-database transcript sequences, and are detailed in Supplementary Table 2.

Walter R.J., Sonnentag S.J., Munoz-Sagredo L., Merkel M., Richert L., Bunert F., Heneka Y.M., Loustau T., Hodder M., Ridgway R.A., Sansom O.J., Mely Y., Rothbauer U., Schmitt M, & Orian-Rousseau V. (2022). Wnt signaling is boosted during intestinal regeneration by a CD44-positive feedback loop. Cell Death & Disease, 13(2), 168.

+ Open protocol

+ Expand

Reverse Transcription for RNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA was synthesized using the Superscript III first strand synthesis kit (InVitrogen, Carlsbad, California) and RQ1 DNase (Promega, Madison, Wisconsin) to ensure no genomic DNA contamination. Approximately 500 ng of RNA was incubated at 37°C for 60 min with 10× Superscript III RT buffer, magnesium chloride, and RQ1 RNase‐free DNase. DNase STOP solution (Promega) was then added to each sample and incubated at 65°C for a further 10 min. Subsequently, random hexamers and 10 mM dNTP mix were added and incubated at 65°C for 5 min and chilled on ice. A cDNA synthesis mix was then prepared using Superscript III RT buffer, 25 mM magnesium chloride, 0.1 M DTT, RNaseOUT, and Superscript III RT. After addition of the cDNA synthesis mix, the samples were incubated at 25°C for 10 min, 50°C for 50 min, and 85°C for 5 mins and chilled on ice. The samples were stored at –80°C until use.

Nicholls A.J., Wen S.W., Hall P., Hickey M.J, & Wong C.H. (2017). Activation of the sympathetic nervous system modulates neutrophil function. Journal of Leukocyte Biology, 103(2), 295-309.

+ Open protocol

+ Expand

RNA Oligomerization in DM1 Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

To determine whether the repeating RNA that causes DM1 serves as a template for oligomerization in cells, DM1-patient-derived fibroblasts containing 500 CUG repeats (GM03987, Coriell Institute) and healthy fibroblasts (GM07492, Coriell Institute) were grown to ~80% confluence in fibroblast growth medium in T-25 dishes and treated with equimolar amounts of 4 and 7 (500 nM each) for 48 h. The cells were washed with 1× DPBS, trypsinized, and pelleted. Cells were washed twice with 1× DPBS and then lysed by adding 0.25 ml of Lysis Buffer (2 ml of Lysis Buffer contains: 2% Triton X-100, 2% NP40, 80 μl RNAsecure (1/25) and 50 μl DNase) for 5 min at room temperature and then 5 μl DNase Stop Solution (Promega) was added.
A 200 μL aliquot of lysate was incubated with streptavidin-agarose beads (100 μl, ≥15 μg/ml binding capacity, Sigma) for 1 h at room temperature. The beads were then washed with 1× PBST and the bound RNA was eluted by adding 20 μl of Elution Buffer for 20 min at 60 °C. Approximately 4 μl of each sample was diluted in 20 μl of water plus 0.1% formic acid and analyzed by LC-MS using a Thermo Scientific LTQ-ETD mass spectrometer. A gradient of 0–100% acetonitrile in water plus 0.1% formic acid over 10 min was used for analysis. Background subtraction of untreated samples was performed before analysis.

Rzuczek S.G., Colgan L.A., Nakai Y., Cameron M.D., Furling D., Yasuda R, & Disney M.D. (2016). Precise small molecule recognition of a toxic CUG RNA repeat expansion. Nature chemical biology, 13(2), 188-193.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

500ng of Total RNA was first subjected to DNase digestion (Promega M6101) at 37°C for 30 minutes to eliminate contaminating genomic DNA. Next, DNase activity was stopped using DNase Stop Solution (Promega M199A) and RNA was reverse transcribed with Random Primers (Promega C1181) and MMLV Reverse Transcriptase (Sigma M1302) according to prescribed protocols. Quantitative Real time PCR (qPCR) was performed using Takyon ROX SYBR 2X MasterMix (Eurogentec UF-RSMT-B0701) as a fluorescent detection dye. All reactions were carried out in a final volume of 7μl in 384 well plates with 300 nM gene specific primers, around 7ng of cDNA (at 100% RT efficiency) and 1X SYBR Master Mix in each well. Each reaction was performed in triplicates. All qPCR experiments were performed on BioRad CFX384.

Sundaram V.K., Sampathkumar N.K., Massaad C, & Grenier J. (2019). Optimal use of statistical methods to validate reference gene stability in longitudinal studies. PLoS ONE, 14(7), e0219440.

+ Open protocol

+ Expand

Quantifying Gene Expression Using Real-Time PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

For Figure 5E, total RNA was extracted from cells using QIAshredder and RNeasy kits (Qiagen). To remove any DNA, the extracts were incubated with DNAse buffer (Promega) and residual DNAse was subsequently inactivated with DNAse stop solution (Promega). cDNA synthesis was performed using LunaScript RT SuperMix Kit (NEB). Polymerase chain reactions were carried out using TaqMan 2× Universal PCR Master Mix or SYBR Green PCR Master Mix (Thermo) on a QuantStudio™ 7 Flex Real-Time PCR System (Thermo). Acidic ribosomal phosphoprotein P0 (36B4), β-actin (b-act) and 18S ribosomal RNA (18s) were used as internal controls. The following primer sets were used: 36B4_F; AGATGCAGCAGATCCGCAT and 36B4_R; GTTCTTGCCCATCAGCACC, b-act_F; GCTCTGGCTCCTAGCACCAT and b-act_R; GCCACCGATCCACACAGAGT, and 18s_F; CGGCTACCACATCCAAGGAA and 18s_R; GCTGGAATTACCGCGGCT, with the corresponding 18s taqman probe GAGGGCAAGTCTGGTGCCAG. The TaqMan gene expression assay (premixed primer set and probes) was used for murine Trarg1 (Mm03992124_m1).

Duan X., Norris D.M., Humphrey S.J., Yang P., Cooke K.C., Bultitude W.P., Parker B.L., Conway O.J., Burchfield J.G., Krycer J.R., Brodsky F.M., James D.E, & Fazakerley D.J. (2022). Trafficking regulator of GLUT4-1 (TRARG1) is a GSK3 substrate. Biochemical Journal, 479(11), 1237-1256.

+ Open protocol

+ Expand

Quantifying DNA in Extracellular Vesicles from HUT102 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was isolated from 2 k (6.27 × 10¹¹ particles/mL), 10 k (6.37 × 10¹¹ particles/mL), and 100 k (8.47 × 10¹¹ particles/mL) HUT102 EVs and HUT102 cell lysates (controls and standards) using the GoScript Reverse Transcription System (Promega) and concentration determined using NanoDrop 1000 Spectrophotometer (Thermo Scientific). EVs were evaluated in titration at volumes of 0.5, 1, and 2 μL for each EV. To evaluate if DNA bound to histones was present in the membrane of EVs or encapsulated, EV samples were treated with Proteinase K (Sigma, Cat# P4850) alone at 95 °C for 3 min, or with DNase I (Promega, Cat# M6101) and RNase A (Abcam, Cat# G117) at 37 °C for 1 h prior to addition of DNase Stop Solution (Promega, Cat# M199A) 65 °C for 5 min. DNA was isolated using the Wizard® Genomic DNA Purification Kit according to the manufacturer’s protocol (Promega Corporation) and quantified via qPCR using primers (IDT Technologies) specific for GAPDH (GAPDH-Forward 5′-TGT AGT TGA GGT CAA TGA AGG G-3′, Tm = 64.5 °C; and GAPDH Reverse 5′-ACA TCG CTC AGA CAC CAT G-3′, Tm = 64.5 °C). Serial dilutions of DNA from HUT102 cells were used as quantitative standards. PCR conditions were as follows: for GAPDH primers 50 °C for 2 min, 95 °C for 2.5 min, then 39 cycles of: 95 °C for 15 s, 50 °C for 30 s, and 72 °C for 40 s. The quantification of samples and reactions were carried out as described above.

Pinto D.O., Al Sharif S., Mensah G., Cowen M., Khatkar P., Erickson J., Branscome H., Lattanze T., DeMarino C., Alem F., Magni R., Zhou W., Alais S., Dutartre H., El-Hage N., Mahieux R., Liotta L.A, & Kashanchi F. (2021). Extracellular vesicles from HTLV-1 infected cells modulate target cells and viral spread. Retrovirology, 18, 6.

+ Open protocol

+ Expand

Exosome DNA Extraction and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Exosome DNA was extracted from the UC and serum pellets using the QIAamp MiniElute kit (57414, QIAGEN, Hilden, Germany). Prior to lysis, when indicated, exosome samples were incubated with DNase I (25 U/mL, 9PIM610, Promega, Madison, WI, USA) for 30 min at 37°C, and the reaction was terminated by incubation with DNase stop solution (Promega) for 5 min at 65°C to remove any remaining external DNA associated with the surface of exosomes (Figure S2). For isolation of exosome DNA from pooled SEC fractions 7–10, 500 μL of each fraction was concentrated to 23 μL using Amicon Ultra 0.5-mL centrifugal filters (UFC803024, EMD Millipore, Burlington, MA, USA), followed by DNA extraction using UltraPure phenol:chloroform:isoamyl alcohol (25:24:1, v/v) (15593031, Thermo Fisher Scientific, Waltham, MA, USA) based on the manufacturer’s protocol. DNA from PBMCs (recovered from 1 mL blood) and ∼1 mg tumor tissue was extracted with the DNeasy Blood and Tissue Kit (69506, QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. DNA concentration was measured with the Qubit 3.0 high-sensitivity dsDNA kit (Q32854, Thermo Fisher Scientific, Waltham, MA, USA), and the size range was assessed using the Bioanalyzer 2100 High Sensitivity DNA Kit (5067-4626, Agilent, Santa Clara, CA, USA). All DNA samples were stored at −20°C.

Zhou X., Kurywchak P., Wolf-Dennen K., Che S.P., Sulakhe D., D’Souza M., Xie B., Maltsev N., Gilliam T.C., Wu C.C., McAndrews K.M., LeBleu V.S., McConkey D.J., Volpert O.V., Pretzsch S.M., Czerniak B.A., Dinney C.P, & Kalluri R. (2021). Unique somatic variants in DNA from urine exosomes of individuals with bladder cancer. Molecular Therapy. Methods & Clinical Development, 22, 360-376.

+ Open protocol

+ Expand

Investigating PEITC and Benzo[a]pyrene Effects

Check if the same lab product or an alternative is used in the 5 most similar protocols

Phenethyl isothiocyanate (PEITC), benzo[a]pyrene, Goat anti-mouse polyclonal antibodies (Sigma Co. Ltd., Poole, Dorset, UK), anti-CYP1A1 monoclonal antibodies (AMS Biotechnology, Abingdon, UK), rat genomic DNA (Novagen, Wisconsin, USA), RNase-free DNase, DNase stop solution, DNase buffer (Promega, Wisconsin, USA), Nucleospin® RNA II (Macherey-nigel GmbH & Co, Düren, Germany), RPMI 1640, Earle's balanced salt solution (EBSS), Minimum Essential Medium Alpha (MEM-α), gentamicin, fetal calf serum, Superscript II reverse transcriptase, random hexamers, RNase OUT, RNase-free water, and dNTP mix (Invitrogen, Paisley, Scotland), AbsoluteTM QPCR Mix (Abgene, Epsom, Surrey, UK), were purchased.

Abdull Razis A.F., Konsue N, & Ioannides C. (2015). Inhibitory effect of phenethyl isothiocyanate against benzo[a] pyrene-induced rise in CYP1A1 mRNA and apoprotein levels as its chemopreventive properties. Asian Pacific journal of cancer prevention : APJCP, 16(7).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!