7900ht fast real time pcr detection system

RNA was extracted from ALI-cultured Calu-3 cells using a Qiagen-RNeasy kit (Qiagen, CA, USA), according to the manufacturer’s instructions. RNA concentration and integrity were assessed in a 2100B Bioanalyzer (Agilent Technology). First-stranded cDNA was synthetized using the Superscript III first-strand synthesis System (Invitrogen, Carlsbad, CA, USA). RT–PCR was performed on a 7900HT fast real-time PCR detection system (Applied Biosystems), with the Power SYBR Green PCR Master Mix (Applied Biosystems) and the specific primers described in Table 1. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. Data were expressed asfold increase compared with levels measured in untreated cells by using a ∆∆CT threshold cycle method of calculation. All amplifications were carried out in triplicates.

FFPE specimens are deparaffinized using xylene and ethanol washes as previously described. Samples were digested with protease to recover total RNA. RNA were purified using a rapid glass-fiber filter methodology from Thermo Fisher Scientific (Ambion RecoverAll™ Total Nucleic Acid Isolation Kit for FFPE) that includes an on-filter DNase treatment to remove contaminated genomic DNA. Purified RNA samples are eluted with nuclease free water for cDNA synthesis and quantitative RT-PCR analysis.
The reverse transcription of miRNAs to cDNAs were conducted using TaqMan miRNA RT kit from Thermo Fisher Scientific (Life Technologes) by combining primers for different miRNAs using 40 ng of purified total RNA. Multiplex qRT-PCR reactions were performed using the Thermo Fisher Scientific (Applied Biosystems Inc.) 7900HT Fast Real Time PCR Detection System with 95°C for 10 min, then 40 cycles of 95°C for 15 seconds, 60°C for 60 seconds. miRNA level was analyzed with its specific primers and internal housekeeping control miR-16. Fluorescent signals from each sample were collected at the endpoint of every cycle, and the expression level of each unique miRNA was calculated by ΔΔC_T values based on the internal controls, normalized to control group and plotted as relative value (RQ).

Total RNA from MEF cells was prepared [17 (link)] by using RNeasy Mini Kit (Qiagen, 74106) and quantitated using NanoDrop ND 1000 spectrophotometer (Thermo Fisher Scientific). Real time PCR was performed using 7900HT Fast Real-Time PCR detection system (Applied Biosystems). Primers and probes used for mRNA detection were as follow: CASP3 (Hs00234387_m1), XIAP (Mm01311594_mH), and GAPDH (Hs03929097_g1).

Total RNA was extracted from ten whole adult flies per genotype using standard Trizol (Invitrogen) protocols. cDNA was prepared using SuperScript VILO cDNA synthesis kit (Invitrogen) according to the manufacturer’s protocol. Quantitative RT-PCR was performed using the Applied Biosystems 7900HT Fast Real-Time PCR detection system and Power SYBR Green PCR Master Mix (Applied Biosystems). Relative quantities of Dp110 transcripts were determined using the relative standard curve method and normalized to RP49. Primer sequences were:
Dp110-forward: GCAAGATGCGACCGCTATG; Dp110-reverse: GAAACGCGATGGTATGGACT
RP49-forward: ATGACCATCCGCCCAGCATACAGG; RP49-reverse: ATCTCGCCGCAGTAAACG

Reverse transcription (RT) was done using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). qRT-PCR analysis was carried out using the LightCycler 480 Instrument (Roche) or the 7900HT FAST Real-Time PCR detection system (Applied Biosystems). cDNAs were amplified using the GoTaq qPCR Master Mix and the Hot Start Polymerase (Promega). Primer sequences are listed in Supplementary Table S5. Ct values >35 were considered as negative. Each data points for every biological replicate was analyzed in triplicate. Quantification was performed using the relative ΔCt method. 28S or cyclophilin A genes were used as internal controls.