Primerscript reagent kit
The PrimerScript™ reagent kit is a high-performance reverse transcription (RT) kit designed for efficient and reliable cDNA synthesis from RNA samples. The kit includes a thermostable reverse transcriptase enzyme, RNase inhibitor, and optimized reaction buffers.
Lab products found in correlation
14 protocols using primerscript reagent kit
Liver RNA Extraction and qPCR Analysis
Liver RNA Extraction and RT-qPCR Analysis
The expression of genes in liver was measured using real-time quantitative PCR (RT-qPCR) with SYBR Premix Ex Taq II kit (Tli RNaseH Plus; Takara Biotechnology) and an ABI 7300 Fast Real-Time PCR detection system (Applied Biosystems). The 20 μL reaction system included 2 μL of cDNA template, 0.4 μL of ROX reference dye (50×), 10 μL of SYBR Premix Ex Taq (2×), 0.4 μL of each forward and reverse primer, and 6.8 μL of double-distilled H2O. The RT-qPCR cycling conditions were as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. All of the samples were run in triplicate, and the mRNA expression level of genes were calculated using the 2−ΔΔCt method and normalized to the value of the reference gene β-actin. The final result of each target gene expression was expressed as the percentage of the CONT group. Primer sequences are shown in
Quantification of Tight Junction Proteins
The gene-specific primers of occludin, claudin-2 and ZO-1 were synthesized by Invitrogen Biotech Co. Ltd (Shanghai, China) and are listed in
Quantification of miR-665 and CRIM1 mRNA
Quantitative PCR Analysis of HMGB1 Expression
Comprehensive RNA Extraction and qRT-PCR Protocol
implemented by TRIZOL reagent (Invitrogen). After that, the PrimerScript™
reagent kit (TaKaRa, Shiga, Japan) was usedto obtain cDNA. Then, we implement
SYBR Premix Ex Taq II (TaKaRa) to exert the qRT-PCR following the manufacturer’s
instructions. GAPDH and U6 were used as the internal reference. All Primer
sequences were designed by RiboBio (Guangzhou, China). Primer sequences of
related genes for RT-qPCR:
ATF6: forward 5’-CCAGCAGAAAACCCGCATTC-3’ and reverse
5’-AACTTCCAGGCGAAGCGTAA-3’;
GRP78: forward 5’-AACCCAGATGAGGCTGTAGCA-3’ and reverse
5’-ACATCAAGCAGAACCAGGTCAC-3’;
β-catenin: forward 5’- TGACAAAACTGCTAAATGACGAGG -3’ and reverse
5’-CGCATGATAGCGTGTCTGGA-3’;
c-myc: forward 5’- CCACGAAACTTTGCCCATAG -3’ and reverse
5’- TGCAAGGAGAGCCTTTCAGAG-3’;
Cyclin D1: forward 5’- TGTCCCACTCCTACGATACGC -3’ and reverse
5’- CAGCATCTCATA AACAGGTCACTA C-3’;
LAMC1: forward 5′-ATTTCAATCAACCGCTCT-3’ and reverse
5’-GTTATGGACCTCCTTCGT -3’;
GAPDH: forward 5’-GACGTAGGGAGTGAAGGTC-3’ and reverse
5’-GAGAGTTCAGATGTTGATGG-3.’
Quantitative Analysis of miRNA Expression
Quantitative Expression Analysis of Genes and miRNAs
Skin Tissue RNA Extraction and qPCR Analysis
Quantitative Gene Expression Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!