The iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) was used to synthesise cDNA from 100 ng RNA. Primers were designed to exons 13 and 16 of FLT3 (Supplementary Table 3 ). PCR was performed using peqGOLD Taq DNA polymerase (Peqlab, Erlangen, Germany).
Peqgold taq dna polymerase
Manufactured by Avantor
Sourced in Germany
PeqGOLD Taq DNA polymerase is a thermostable DNA polymerase enzyme used for PCR amplification. It exhibits 5'-3' DNA polymerase activity and 5'-3' exonuclease activity.
Automatically generated - may contain errors
Lab products found in correlation
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Fastdna spin kit for soil, by Qbiogene (1 mentions)
Innuprep doublepure kit, by Analytik Jena (1 mentions)
Smart race cdna amplification kit, by Takara Bio (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Midori green, by Nippon Genetics (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
3130 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator kit, by Thermo Fisher Scientific (1 mentions)
Exosap it, by Thermo Fisher Scientific (1 mentions)
Gelred, by Biotium (1 mentions)
Qiaamp dna ffpe tissue kit, by Qiagen (1 mentions)
8 protocols using peqgold taq dna polymerase
1
FLT3 Gene Expression Analysis
2
Benthic Bacterial Community Analysis by ARISA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After six and twelve weeks, one corer sample (Ø 2.5 cm, 1 cm depth) per EU was collected, transferred into 50 ml plastic tubes and stored frozen at −20 °C for bacterial community analysis. The samples were subjected to total community DNA extraction using the FastDNA SPIN Kit for Soil (Qbiogene, Carlsbad, CA) including an additional heating step to increase yield and final elution of the DNA in TE-buffer. Benthic bacterial community structures were determined by means of the high-throughput fingerprinting technique ARISA, following a previously published procedure by Ramette43 (link) with slight modifications: Final concentrations of PCR ingredients within 50 μl-reactions were 0.4 μM of each primer, 0.1 mg ml−1 BSA, 250 μM of each dNTP (peqGOLD Kit; Peqlab, Erlangen, Germany), 1x Buffer S with 1.5 mM MgCl2(Peqlab), 1.0 mM extra MgCl2 (Peqlab) and 2.5 U peqGOLDTaq-DNA-Polymerase (Peqlab). The forward primer was labelled with FAM at its 5′-end. For each sample (EU), three PCR replicates were prepared. For two samples (EUs) a successful amplification could not be validated, they were therefore excluded from further analyses.
3
Rapid Amplification of cDNA Ends
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SMART RACE cDNA Amplification Kit (Clontech) was used. First-strand cDNA was synthesized from 5 μg RNA, primed with the adaptor-linked oligo(dT) primer 3′-CDS, as described in the instructions for the synthesis of 3′-RACE-ready cDNA. In case of 5′-RACE, the reverse GSPs used to synthesize the first-strand 5′-RACE-ready cDNA of the respective genes were CYP81-5RACE1 and CPR-5RACE1 (Supplementary Table 7 ). Touchdown PCR was employed for the subsequent amplification step. The 25 μl reaction mixture contained 1 μl each of the cDNA samples in 1 × reaction buffer Y, 0.4 mM dNTPs, 0.4 μM primers and 1.25 U peqGOLD Taq-DNA-Polymerase (Peqlab). The PCR conditions were as follows. Initial denaturation at 94 °C for 2 min; 10 cycles with 94 °C for 30 s, annealing at the Tm of the respective GSPs for 45 s with ΔT −0.5 °C per cycle, 72 °C for 90 s; 30 cycles with 94 °C for 30 s, annealing at the Tm of the respective GSPs −5 °C for 45 s, 72 °C for 2 min; and final extension at 72 °C for 15 min. The RACE products were run on an agarose gel stained with Midori Green (Nippon Genetics) and the bands at the expected size were excised and purified using the innuPREP DOUBLEpure Kit (Analytic Jena). The purified products were cloned into the pGEM-T Easy vector (Promega) and sequenced. The primers used for the RACE reactions are listed in Supplementary Table 7 .
4
Genotyping Mitochondrial COI gene in Beroe treatae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We further genotyped a 633 bp region of the mitochondrial cytochrome oxidase I (COI) gene of all 463 B. treatae individuals. Individuals were sequenced using the barcode primers LCO 1490 and HCO 2198 [42 (link)]. PCR reactions were performed in a total volume of 10 μl containing 10× reaction buffer Y (Peqlab, Germany), 800 μM dNTPs, 0.3 μM of each Primer, 0.5 U peqGold Taq DNA polymerase (Peqlab, Germany) and 1 μl template DNA. The thermocycler protocol was: 94 °C for 3 min, followed by 34 cycles at 94 °C for 30 s, 55 °C for 45 s, 72 °C for 45 s and a final extension at 72 °C for 7 min. All PCR products were run on a 2% electrophorese gel, visualized by Gel Red nucleic acid gel staining and then Sanger Sequenced by Eurofins MWG Operon (Ebersberg, Germany). Resulting sequences were edited manually and aligned using CodonCode Aligner.
5
Genotyping Alleles in Drone Offspring
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Because ThTh/ThTh homozygous individuals were not detected in our data set, we tested whether both Thar and ThTh are present in the drone offspring of the heterozygous mapping population’s queen (ThTh/Thar). Nineteen drones were collected in the colony and stored in ethanol at −20 °C. One hind-leg per drone was used for DNA extraction with 100 μl Chelex (Walsh et al. 1991 (link)) solution (5%) and 0.1 mg proteinase K, following the standard Chelex thermocycler protocol (Walsh et al. 1991 (link)). One microliter of total DNA per drone was subsequently used for PCR amplification of a 383 bp DNA fragment (508,685–509,068 bp) downstream of Th (one reaction contained 0.2 μM of each primer [primer 1: GGTTCTCTGTCGCTGCCTAT, primer 2: CCATGGTCAGTTCTTTGTTTCGT], 0.2 mM dNTPs, 0.25 units peqGOLD Taq-DNA-Polymerase and 10× reaction buffer S [both from Peqlab] in a total volume of 10 μl) following a standard PCR protocol (5 min at 94 °C, 38 cycles of 30 s at 94 °C, 30 s at 60 °C, 60 s at 72 °C, 15 min at 72 °C). PCR products were purified (QIAquick PCR Purification Kit, Qiagen) and Sanger sequenced (Eurofins Genomics, Germany) in one direction. Sequences were analyzed in BioEdit (Hall 1999 ) (v7.0.4) regarding a 3-bp deletion (508,880–50,882 bp) for which the presence (associated with ThTh) or the absence (associated with Thar) was determined.
6
Molecular Identification of Insect Specimens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extractions were performed following the method of Knölke et al. (2005) (link) and with the NucleoSpin Tissue kit by Magerey-Nagel according to the manufacturer’s protocol. For alcohol preserved specimens, only tissue from the thorax was used for DNA extraction. For dried specimens, DNA was extracted from the abdomen or a leg, when the abdomen was missing.
The primers used are recorded inTable 4 .
PCRs were performed using peqGOLD Taq DNA polymerase (PeqLab). In cases of weak or absent PCR result, a re-examination PCR was done using BIO-X-ACT Short Taq polymerase (Bioline). PCR protocols are given inAppendix II - Tables 1 and 2 . Potential contamination was tested along with PCRs by control sample without DNA.
Success of gene amplification was evaluated by an electrophoresis with 1% agarose gel, subsequent gel dying with GelRed and analysis under ultraviolet light. PCR products were purified using ExoSAP-IT (USB Corporation).
Sequence PCR was done with the BigDye Terminator-Kit of Applied Biosystems. The amount of each product is reported inAppendix II - Table 3 . The PCR programme is reported in the BigDye Terminator Sequencing Kit protocol. The sequences were obtained from the sample analysis on a 3130 Genetic Analyzer (Applied Biosystems).
The primers used are recorded in
PCRs were performed using peqGOLD Taq DNA polymerase (PeqLab). In cases of weak or absent PCR result, a re-examination PCR was done using BIO-X-ACT Short Taq polymerase (Bioline). PCR protocols are given in
Success of gene amplification was evaluated by an electrophoresis with 1% agarose gel, subsequent gel dying with GelRed and analysis under ultraviolet light. PCR products were purified using ExoSAP-IT (USB Corporation).
Sequence PCR was done with the BigDye Terminator-Kit of Applied Biosystems. The amount of each product is reported in
7
Detecting Merkel Cell Polyomavirus in FFPE Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from paraffin embedded MC samples was prepared using the QIAamp DNA FFPE Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Three 5μm sections were used from each sample. Five samples, which were negative and 5 samples, which showed positive immunostaining were used for PCR. The MLK1 Merkel cell carcinoma cell line was used as positive control for the establishment of the MCPyV PCR (Fig 2 ). Conventional PCRs were performed in a volume of 50 μL containing 0.25 μL peqGOLD Taq-DNA-Polymerase (PEQLAB, Erlangen, Germany), 5 μL 10× reaction buffer Y (PEQLAB), 10 μl 5x enhancer solution (PEQLAB), 1μL dNTPs (25 mM), 1.5 μL of each primer (10 μM), and 30.75 μL H2O. The following forward and reverse primers were synthesized by VBC Genomics (VBC Genomics, Vienna, Austria): for MCPyV (forward: 5′-GATCAGGAGGATTCAGCTTCG-3′ , reverse: 5′-CAGAGGATGAGGTGGGTTCC-3′ ) and for genomic DNA (Loricrin; forward: 5′-GGAGTTGGAGGTGTTTTCCA-3′ , reverse: 5′-ACTGGGGTTGGGAGGTAGTT-3′ ). The PCR included 2 min at 95°C for initial denaturing, followed by 35 cycles of 15 s at 95°C, 15 s at 55°C, 50 s at 72°C, and a final extension step at 72°C for 10 min. Amplicons were subjected to electrophoresis in a 1.0% Agarose gel containing GelRed™ (Biotium, Fremton, CA). The specificity of the PCR products was confirmed by sequencing (not shown).
8
FLT3 Gene Expression Profiling
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!