To clone the T. gondii MIC8 gene into the baculovirus expression vector (pFastBac), the total RNA was extracted from the T. gondii RH strain using RNeasy Mini Kit (Qiagen, Valencia, USA). The total RNA was reversely transcribed to cDNA using Prime Script 1st strand cDNA synthesis kit according to the manufacturer’s instructions (Takara, Otsu, Japan). The cDNA was used as a template to amplify the complete coding sequence T. gondii MIC8 by polymerase chain reaction (PCR). The primers were designed from the nucleotide sequence of MIC8 in GenBank (accession number: AF353165): forward (AAAGAATTCACCATGAAGGCCAATCGAATATG ) and reverse (TTACTCCAGTTAGGACCAGATACCGCCCGA ) with EcoRI and XhoI restriction enzyme sites (underlined). The PCR product was inserted into the pFastBac plasmid (Invitrogen, Carlsbad, USA). For M1 gene cloning, whole procedure was followed as described [23 (link)]. The constructs containing M1 (accession number: EF467824, 1.027bp) and MIC8 (accession number: AF353165, 2.055bp) genes in the pFastBac vector were confirmed by DNA sequencing. The recombinant plasmids were transformed into a DH10-Bac, extracted using FavorPrep gel purification Kit (Favorgen, Cheshire, UK), and stored at –20°C until used.
Pfastbac plasmid
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PFastBac plasmid is a versatile vector used for the expression of recombinant proteins in insect cells. It contains the necessary elements for the generation of recombinant baculoviruses, which can then be used to infect insect cells and drive the production of the target protein.
Automatically generated - may contain errors
Lab products found in correlation
Primescript 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Favorprep gel purification kit, by Favorgen Biotech (1 mentions)
Pfastbac, by Thermo Fisher Scientific (1 mentions)
Anti rgs his antibody, by Qiagen (1 mentions)
Ni nta agarose bead, by Qiagen (1 mentions)
3 protocols using pfastbac plasmid
1
Cloning MIC8 Gene into Baculovirus Vector
2
Extracellular IL-13Rα1 Protein Expression
3
Recombinant HEV p495 Protein Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ORF2 gene fragment of HEV genotype 1, encoding residues 112–606, was cloned into pFastBac plasmid (Invitrogen). Sf9 cells were transfected by lipofection to produce recombinant viruses. Tn5 cells in ESF 921 were infected with the recombinant baculoviruses for 4 d at 30 °C. The target proteins (p495) were mainly secreted into the culture medium. p495 in the cell culture supernatant was concentrated by incubation with 8% polyethylene glycol 6,000 in the presence of 0.4-M NaCl at 4 °C overnight. The precipitate was resuspended in 20-mM phosphate buffer pH 6.0 (PB6.0) and purified using a diethylaminoethyl (DEAE)-5PW column.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!