Superscript rnase reverse transcriptase

RNA was isolated from individual cell lines and frozen human thyroid tissue using Direct-zol RNA Miniprep kit (ZYMO, R2052) and quantified by Nanodrop 2000 (Thermo Scientific). RNA was reverse transcribed to cDNA using random primer and Superscript RNase Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) and amplified using the StepOne Plus real-time PCR platform (ABI/Life Technologies). qRT-PCR was performed with denaturation at 95°C for 3 minutes, followed by 40 cycles of denaturing at 95°C for 10 seconds and annealing-extension at the optimal primer temperatures for 60 seconds. Target gene threshold cycles (Ct) were analyzed according to the 2-ΔΔCt method relative to human beta actin housekeeping gene. All analyses were performed in triplicate. Primer sequences can be found in Supplementary Material.

Total RNA was isolated from tissues using peqGold TriFast (peqlab, Biotechnologie GmbH, Germany) according to the manufacturers’ protocol. To remove genomic DNA contamination, isolated RNA samples were treated with 1 U DNAse/μg RNA (Invitrogen, Karlsruher, Germany) for 15 min at 37°C. One μg of RNA was used in a 10 μl reaction to synthesize cDNA using Superscript RNase Reverse Transcriptase (200 U/μg RNA, Invitrogen, Karlsruhe, Germany) and oligo dTs as primers. RT reaction was performed for 50 min at 37°C. Real-time quantitative PCR was performed using CFX Meastro detection system (Bio-Rad, Munich, Germany) in combination with the iTaq Universal SYBR Green Real-Time PCR Supermix (Bio-Rad, Munich, Germany). Quantification was performed as described by Livak and Schmittgen (2001) (link). Primer sequences are listed in Supplementary Table 1.

RNA was isolated from liver samples and isolated cardiomyocytes using peqGold Trifast (peqlab, Biotechnologie GmbH, Erlangen, Germany) according to manufacturer’s protocol. To avoid genomic DNA contamination, samples were treated with DNase (1U/ µg RNA; Invitrogen, Karslruhe, Germany) for 15 min at 37 °C. The Reverse Transcription of RNA (1 µg/10 µl) into cDNA was performed with Superscript RNase reverse transcriptase (200 U/µg RNA; Invitrogen) and oligo dTs at 37 °C for 60 min. Quantitative Real-Time PCR was performed using the Icycler MyiQ® detection systems (Bio-Rad, Munich, Germany) in combination with IQ SYBR green real-time supermix (Bio-Rad, Munich, Germany). Primer for surfeit locus protein-4 (SURF-4) and beta-2-microglobulin (B2M) (Table 1) were used and quantification was performed applying the ΔΔ Ct method [20 (link)].Table 1

List of primer used in this study

Gene	Forward	Reverse
B2M	GCCGTCGTGCTTGCCATTC	CTGAGGTGGGTGGAACTGAGAC
SURF-4	ATTTCGCCGACCAGTTCCTT	CAGGTAACCACAGCTCCAGG
PCSK9 (human)	CACCATGGGCACCGTCAGCTCCAG	AAACTGGAGCTCCTGGGAGGCC
PCSK9 (mouse)	TTGAACAAACTGCCCATCGC	CCCAACAGGTCACTGCTCAT