Biodyne firepol master mix

DNA from whole blood samples of study subjects was extracted through organic (phenol-chloroform) extraction protocol [40 (link)]. The primers for variants analysis were designed using Primer 1 software [41 ]. Four primers were designed for genotyping of each genetic variant. Two outer primers and two internal primers were designed in such a manner that they must amplify that region of the gene which carrying the targeted variants. Primers were also validated by UCSC In silico PCR [42 ]. The genotyping analysis for variants rs1553369874 (E14K) and rs1345511001 ( D39H) was performed through Tetra-ARMS PCR in Veriti™ 96-Well Thermal Cycler of Applied Biosystems™. Reaction mixture of 25 µl was prepared for every sample using Solis BioDyne FIREPol® Master Mix with 7.5 mM MgCl₂. The primer sequences and parameters for PCR-reaction are given in Table 1. The amplified product was analyzed by agarose electrophoresis (2% W/V) under UV-transilluminator.
Table 1

Sequences and parameters of primers used for genotyping of rs1553369874 and rs1345511001

Variant rs IDs	Primer sequences	Tm°C	Ta°C	Product size
	CTTCTTAAGATCAAAATCTTCA			G-allele − 196
rs1553369874(G/A)	CTTCAAGCTCACGGCATC	53.9 0 C	72 0 C	A-allele − 169
	CACAAGGTGTAGGGAGTGT			Outer-band − 325
	GCTGTTGGTCTTCTGCTT
	CGCAGACTTTCCTTCACC			G-allele − 192
rs1345511001 (G/C)	AGGGCAATGTAGGGCTC	55.6 0 C	72 0 C	C-allele − 212
	TTCTTCATTCCTGCCCTC			Outer-band − 369
	TCAAACTGGATGGTGCAG

DNA from whole blood samples of study subjects was extracted through organic (phenol-chloroform) extraction protocol [40 (link)]. The primers for variants analysis were designed using Primer 1 software [41 ]. Four primers were designed for genotyping of each genetic variant. Two outer primers and two internal primers were designed in such a manner that they must amplify that region of the gene which carrying the targeted variants. Primers were also validated by UCSC In silico PCR [42 ]. The genotyping analysis for variants rs1553369874 (E14K) and rs1345511001 ( D39H) was performed through Tetra-ARMS PCR in Veriti™ 96-Well Thermal Cycler of Applied Biosystems™. Reaction mixture of 25 µl was prepared for every sample using Solis BioDyne FIREPol® Master Mix with 7.5 mM MgCl₂. The primer sequences and parameters for PCR-reaction are given in Table 1. The amplified product was analyzed by agarose electrophoresis (2% W/V) under UV-transilluminator.
Table 1

Sequences and parameters of primers used for genotyping of rs1553369874 and rs1345511001

Variant rs IDs	Primer sequences	Tm°C	Ta°C	Product size
	CTTCTTAAGATCAAAATCTTCA			G-allele − 196
rs1553369874(G/A)	CTTCAAGCTCACGGCATC	53.9 0 C	72 0 C	A-allele − 169
	CACAAGGTGTAGGGAGTGT			Outer-band − 325
	GCTGTTGGTCTTCTGCTT
	CGCAGACTTTCCTTCACC			G-allele − 192
rs1345511001 (G/C)	AGGGCAATGTAGGGCTC	55.6 0 C	72 0 C	C-allele − 212
	TTCTTCATTCCTGCCCTC			Outer-band − 369
	TCAAACTGGATGGTGCAG

DNA from whole blood samples of study subjects was extracted through organic (phenol-chloroform) extraction protocol [40 (link)]. The primers for variants analysis were designed using Primer 1 software [41 ]. Four primers were designed for genotyping of each genetic variant. Two outer primers and two internal primers were designed in such a manner that they must amplify that region of the gene which carrying the targeted variants. Primers were also validated by UCSC In silico PCR [42 ]. The genotyping analysis for variants rs1553369874 (E14K) and rs1345511001 ( D39H) was performed through Tetra-ARMS PCR in Veriti™ 96-Well Thermal Cycler of Applied Biosystems™. Reaction mixture of 25 µl was prepared for every sample using Solis BioDyne FIREPol® Master Mix with 7.5 mM MgCl₂. The primer sequences and parameters for PCR-reaction are given in Table 1. The amplified product was analyzed by agarose electrophoresis (2% W/V) under UV-transilluminator.
Table 1

Sequences and parameters of primers used for genotyping of rs1553369874 and rs1345511001

Variant rs IDs	Primer sequences	Tm°C	Ta°C	Product size
	CTTCTTAAGATCAAAATCTTCA			G-allele − 196
rs1553369874(G/A)	CTTCAAGCTCACGGCATC	53.9 0 C	72 0 C	A-allele − 169
	CACAAGGTGTAGGGAGTGT			Outer-band − 325
	GCTGTTGGTCTTCTGCTT
	CGCAGACTTTCCTTCACC			G-allele − 192
rs1345511001 (G/C)	AGGGCAATGTAGGGCTC	55.6 0 C	72 0 C	C-allele − 212
	TTCTTCATTCCTGCCCTC			Outer-band − 369
	TCAAACTGGATGGTGCAG