Purelink rna columns

Tissues (spinal cords and spleen) were freshly collected and immediately frozen on dry-ice. The ventral portion of lumbar spinal cord and a segment of spleen was homogenized, and total RNA from spinal cord was extracted using the Trizol method (Invitrogen) and purified with PureLink RNA columns (Life Technologies). RNA samples were treated with DNase I and reverse transcription was performed with High Capacity cDNA Reverse Transcription Kit (Life Technologies). Real-time PCR was performed using the Taq Man Gene expression assay (Applied Biosystems) following the manufacturer’s instructions, on cDNA specimens in triplicate, using 1x Universal PCR master mix (Life technologies) and 1x mix containing specific receptors probes for the interleukin 1 beta (IL1β Mm00434228_m1), chemokine (C-C motif) ligand 2 (CCL2, Mm00441242_m1), interleukin 4 (IL-4, Mm00445259_m1), chitinase-like 3 (Ym1, Mm00657889_mH), forkhead box P3 (FoxP3, Mm00475162_m1), and cluster of differentiation 4 (CD4, Mm00442754_m1) (Life Technologies). Relative quantification was calculated from the ratio between the cycle number (Ct) at which the signal crossed a threshold set within the logarithmic phase of the given gene and that of the reference β-actin gene (4310881E; Life technologies). Mean values of the triplicate results for each animal were used as individual data for 2^−ΔΔCt statistical analysis.

RNA was extracted from the TA muscles using Trizol (Invitrogen, Waltham, MA, USA) and purified with PureLink RNA columns (Life Technologies, Carlsbad, CA, USA). The RNA samples were then treated with DNase I and reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies, Carlsbad, CA, USA). A real-time PCR was carried out on the cDNA specimens in triplicate, using the Taq Man Gene expression assay (Applied Biosystems, Waltham, MA, USA) according to the manufacturer’s instructions, with 1x Universal PCR master mix (Life Technologies, Carlsbad, CA, USA) and 1x mix containing specific receptor probes (Life Technologies, Carlsbad, CA, USA). Relative quantification was calculated by determining the ratio between the cycle number (Ct) at which the signal crossed a threshold set within the logarithmic phase of the target gene and that of the reference β-actin gene (4310881E; Life Technologies, Carlsbad, CA, USA). The mean values of the triplicate results for each animal were used as individual data for a 2-ΔCt statistical analysis. The probes used for the real-time PCR were tumor necrosis factor-alpha (TNF-alpha) (Mm00443258_m1; Life Technologies, Carlsbad, CA, USA), interleukin 1β (Il-1β; Mm00434228_m1; Life Technologies, Carlsbad, CA, USA), and interleukin 10 (Il-10; Mm00439614_m1; Life Technologies, Carlsbad, CA, USA).

The spinal cords, sciatic nerves, and muscles were perfused in 0.1 M PBS, freshly collected and then frozen on dry ice. The total RNA from spinal cord was extracted using the Trizol method (Invitrogen) and purified with PureLink RNA columns (Life Technologies). For fibrous tissues (sciatic nerve and muscles), the RNeasy® Mini Kit (Qiagen) was used. The RNA samples were treated with DNase I, and reverse transcription was done with a High Capacity cDNA Reverse Transcription Kit (Life Technologies). For quantitative reverse transcription PCR (RT-qPCR), we used the TaqMan Gene expression assay (Applied Biosystems) following the manufacturer’s instructions, on complementary DNA (cDNA) specimens in triplicate, using 1X Universal PCR master mix (Life technologies) and 1X mix containing specific receptor probes. The levels of transcripts were normalized to β-actin. The mean values of the triplicate results for each animal were used as individual data for 2^−ΔΔCt statistical analysis. Additional information is supplied in the Additional file 1.

RNA was extracted from GCM using TRIzol (Invitrogen) and purified with PureLink RNA columns (Life Technologies). These RNA samples were treated with DNase I and underwent reverse transcription using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies). Real-time PCR analysis was conducted using the TaqMan Gene expression assay (Applied Biosystems) following the manufacturer's recommended protocols. The reactions were performed on triplicate cDNA specimens, employing 1× Universal PCR Master Mix (Life Technologies) and a 1× mix containing specific receptor probes (Life Technologies).
Relative quantification was determined by calculating the ratio between the cycle number (Ct) at which the signal crossed a threshold set within the logarithmic phase of the target gene and that of the reference β-actin gene (4310881E; Life Technologies). The results were used for a 2-ΔCt statistical analysis. The following probes were employed: nicotinic cholinergic receptor, gamma subunit (AChRγ) (CHRNG; Mm00437419_m1; Life Technologies), interleukin 1β (Il-1β; Mm00434228_m1; Life Technologies), interferon-γ (IFNγ) (Mm01168134_m1; Life Technologies).

Real-time PCR analyses were carried out to evaluate the mRNA levels of ACTA2, FN1, COL1A1, HDAC4, TNC, SPARC, BMP2, BMP4, and BMP6. hDFs and hDPSCs were homogenized, and total RNA was extracted and purified using the PureLink RNA columns (Thermo Fisher Scientific). cDNA synthesis was performed using Maxima First Strand cDNA Synthesis Kit with DNase I treatment (Thermo Fisher Scientific). Quantitative real-time PCRs were performed using SYBR Green Master Mix (Bio-Rad) on the CFX Connect Real-time PCR instrument (Bio-Rad, Hercules, CA, United States) with the oligonucleotides. The oligonucleotides used in this study are listed in Table 1 (all obtained from Sigma-Aldrich).
Relative quantification was calculated from the ratio of the cycle number (Ct) at which the signal crossed a threshold set within the logarithmic phase of the given gene to that of the reference hRPLP0. Mean values of the duplicate results of three independent experiments for each sample were used as individual data for 2^−ΔΔCt statistical analysis.

Human PBMCs cells were homogenized, and total RNA was extracted and purified using the PureLink RNA columns (Thermo Fisher Scientific). cDNA synthesis was performed by using Maxima First Strand cDNA Synthesis Kit with DNase I treatment (Thermo Fisher Scientific). Quantitative real-time PCRs were performed using SYBR Green Master mix (Bio-Rad Laboratories) on CFX Connect Real-time PCR instrument (Bio-Rad Laboratories), with the following oligonucleotides: hRPLP0 (F: TACACCTTCCCACTTGCTGA, R: CCATATCCTCGTCCGACTCC); hIL-2 (F: AAAGAAAACACAGCTACAACTGG, R: GAAGATGTTTCAGTTCTGTGGC); hIFNγ (F: GCATCGTTTTGGGTTCTCTTG R: AGTTCCATTATCCGCTACATCTG), hTNFα (F: ACTTTGGAGTGATCGGCC, R: GCTTGAGGGTTTGCTACAAC), hIL-6 (F: CCACTCACCTCTTCAGAACG, R: CATCTTTGGAAGGTTCAGGTTG), hFasL (F: AAAGGAGCTGAGGAAAGTGG; R: CATAGGTGTCTTCCCATTCCAG); hCCL5 (F: TGCCCACATCAAGGAGTATTTC, R: CCATCCTAGCTCATCTCCAAAG); hCXCL10 (F: CCTTATCTTTCTGACTCTAAGTGGC, R: ACGTGGACAAAATTGGCTTG); hIL-10 (F: CAGAGTGAAGACTTTCTTTCAAATG, R: CCTTTAACAACAAGTTGTCCAGC).
Relative quantification was calculated from the ratio between the cycle number (Ct) at which the signal crossed a threshold set within the logarithmic phase of the given gene and that of the reference hRPLP0. Mean values of the duplicate results of three independent experiments for each sample were used as individual data for 2^−ΔΔCt statistical analysis.