Log In Sign up
The largest database of trusted experimental protocols

Taqman universal master mix reagent

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

TaqMan universal master mix reagent is a ready-to-use solution designed for real-time PCR amplification. It contains all the necessary components, including DNA polymerase, dNTPs, and TaqMan probe, required for efficient and reliable gene expression analysis.

Automatically generated - may contain errors

Lab products found in correlation

Direct zol rna miniprep kit, by Zymo Research (3 mentions) Taqman gene expression assay, by Thermo Fisher Scientific (3 mentions) Taqman rna reverse transcription kit, by Thermo Fisher Scientific (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Qiaamp dna mini kit, by Qiagen (2 mentions) Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions) Taqman reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Rneasy kit, by Qiagen (1 mentions) Taqman primer, by Thermo Fisher Scientific (1 mentions) Quantstudio 12k flex system, by Thermo Fisher Scientific (1 mentions) High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions) Taqman reverse transcription reagent, by Thermo Fisher Scientific (1 mentions) Cd11b apc efluor780, by Thermo Fisher Scientific (1 mentions) Chemiluminescent hrp substrate, by Thermo Fisher Scientific (1 mentions) Cd45 efluor450, by Thermo Fisher Scientific (1 mentions) Ly6c percp cy5, by Thermo Fisher Scientific (1 mentions) Bca protein estimation kit, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

TaqMan Master Mix (448 citations) TaqMan reagents (162 citations) Universal Master Mix (122 citations) Taqman master mix reagent (7 citations) Taqman universal mix (6 citations) TaqMan Universal Fast PCR master mix reagents (5 citations) TaqMan® Reverse Transcription and Universal PCR Master Mix Reagents (2 citations) TaqMan universal PCR master mix reagents kit (2 citations)

9 protocols using taqman universal master mix reagent

1

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated using the Direct-zol RNA Mini-Prep kit (Zymo Research, cat# R2051), following manufacturer’s instructions. For cDNA synthesis, the Taqman Reverse Transcription kit (Thermo Fisher, cat# N8080234) was used as described by the manufacturer. Real time PCR was performed using Taqman gene expression assays (Thermo Fisher) and Taqman Universal Master Mix reagents (Thermo Fisher, cat# A30865). The primers/probe are identified by the following numbers: GAPDH: Hs02758991_g1, SMS: Hs01924834_u1, RUNX2: Hs01047973, BSP: Hs00173720_m1, CDKN1: Hs00355782_m1, CCND1: Hs00765553_m1, PGK1: Hs00943178_g1, ENO2: Hs00157360_m1, SAT2: Hs01070426_g1, FTH1: Hs01000476_g1, and FTL: Hs00830226_gH.
Ramsay A.L., Alonso-Garcia V., Chaboya C., Radut B., Le B., Florez J., Schumacher C, & Fierro F.A. (2019). Modeling Snyder-Robinson Syndrome in multipotent stromal cells reveals impaired mitochondrial function as a potential cause for deficient osteogenesis. Scientific Reports, 9, 15395.
+ Open protocol
+ Expand
2

Quantifying Steroidogenic Enzymes in Hippocampus and Cortex

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from hippocampus and cortex using the Qiagen RNeasy kit and reverse transcribed using a high-capacity RNA-to-cDNA kit (Applied Biosystems). TaqMan primers were purchased from Thermo Fisher. Gene expression of steroidogenic enzymes (5α-reductase type 1) [Mm00614213], 21-hydroxylase [Mm00487230], 17α-hydroxylase [Mm00484040], and IL-6 (Mm00446190) were quantified using the Quantstudio 12K Flex System (Applied Biosystems, Life Technologies, Waltham, MA) using TaqMan universal master mix reagents (Thermo Fisher). All data were normalized to the housekeeping genes, HPRT [Mm03024075_m1] and GAPDH [Mm99999915_g1] and presented as percent mRNA expression relative to young control groups.
Parks E.E., Logan S., Yeganeh A., Farley J.A., Owen D.B, & Sonntag W.E. (2020). Interleukin 6 reduces allopregnanolone synthesis in the brain and contributes to age-related cognitive decline in mice. Journal of Lipid Research, 61(10), 1308-1319.
+ Open protocol
+ Expand
3

Quantifying Sialyltransferase and Catalase mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
To measure gene expression, total RNA was extracted from MSCs using Direct-zol RNA Miniprep kit (Zymo Research, Irvine, CA, USA), following manufacturer’s instructions. RNA was reverse transcribed using Taqman reverse transcription reagents (Thermo Fisher). mRNA levels of sialyltransferases and catalase were measured using TaqMan gene expression assays (Invitrogen, Carlsbad, CA, USA) and TaqMan Universal Master Mix reagents (Invitrogen). Primers and probe can be identified by the following Assay ID: GAPDH: Hs03929097_g1; ST3Gal1: Hs00161688_m1; ST6Gal1: Hs00949382_m1; ST3Gal4: Hs00920870_m1; Catalase: Hs00156308_m1.
Templeton K., Ramos M., Rose J., Le B., Zhou Q., Cressman A., Ferreyra S., Lebrilla C.B, & Fierro F.A. (2021). Mesenchymal Stromal Cells Regulate Sialylations of N-Glycans, Affecting Cell Migration and Survival. International Journal of Molecular Sciences, 22(13), 6868.
+ Open protocol
+ Expand
4

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA extraction was performed using a Direct-zol RNA Miniprep kit (Zymo Research, Irvine, CA, USA), following the manufacturer’s instructions. Real-time PCR was performed using TaqMan gene expression assays (Invitrogen, Carlsbad, CA, USA) and TaqMan Universal Master Mix reagents (Invitrogen), where the primers and probe are identified by the following Assay ID: MAN1A1: Hs00195458_m1, DOCK4: Hs00206807_m1, PODXL: Hs01574644_m1, RHOB: Hs05051455_s1*, FUT8: Hs00189535_m1, HMGA1: Hs00852949_g1*, HMGA2: Hs04397751_m1, FGFR2: Hs01552918_m1, GAPDH: Hs02786624_g1. For all assays, the probe spans over two exons, except for those with an asterisk (*), where both primers and probe map within a single exon.
Alonso-Garcia V., Chaboya C., Li Q., Le B., Congleton T.J., Florez J., Tran V., Liu G.Y., Yao W., Lebrilla C.B, & Fierro F.A. (2020). High Mannose N-Glycans Promote Migration of Bone-Marrow-Derived Mesenchymal Stromal Cells. International Journal of Molecular Sciences, 21(19), 7194.
+ Open protocol
+ Expand
5

Transcriptional Profiling of MS Microglia

Check if the same lab product or an alternative is used in the 5 most similar protocols
We isolated total RNA from either perilesional cortex or flow-sorted microglia/monocytes of MS P2X4R KO and WT littermate mice using the triazole method. We performed reverse transcription and qPCR as per instructions of the TaqMan® RNA reverse transcription kit (Ambion, Life Technologies, Camarillo, CA) and Taqman universal master mix reagent (Ambion, Life Technologies, Camarillo, CA).
Verma R., Cronin C.G., Hudobenko J., Venna V.R., McCullough L.D, & Liang B.T. (2017). Deletion of the P2X4 receptor is neuroprotective acutely, but induces a depressive phenotype during recovery from ischemic stroke. Brain, behavior, and immunity, 66, 302-312.
+ Open protocol
+ Expand
6

Trizol RNA Extraction and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Trizol (Ambion, Life Technologies Camarillo, CA) method was utilized for total RNA isolation from right hemisphere (perilesional cortex) of vehicle-treated and drug-treated WT mice. Reverse transcription (RT) and qPCR was carried out in accordance with manufacturer instructions - TaqMan RNA reverse transcription kit and TaqMan universal master mix reagent (Ambion, Life Technologies, Camarillo, CA).
Srivastava P., Cronin C.G., Scranton V.L., Jacobson K.A., Liang B.T, & Verma R. (2020). Neuroprotective and Neuro-rehabilitative Effects of Acute Purinergic Receptor P2X4 (P2X4R) Blockade after Ischemic Stroke. Experimental neurology, 329, 113308.
+ Open protocol
+ Expand
7

Multiparametric Phenotypic Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
5-BDBD (Cat. SML0450) was obtained from Sigma-Aldrich, St. Louis, MO. Flow cytometry fluorophores CD45-efluor450 (Cat 48045182), CD11b-APC-eFluor780 (Cat. 47011282), and Ly6C-PerCP-Cy5–5 (Cat. 45593282), as well as Chemiluminescent HRP substrate (Cat. 34580) and BCA Protein estimation kit (Cat. 23227) were procured from Thermo Fisher Scientific Inc., Rockford, IL. Fluorophore Ly6G-PE (Cat 501276U025) was from Tonbo Biosciences, San Diego, CA., IL.
Primary antibodies used in western blot against P2X4R (Cat. 135341AP), BDNF (Cat. 256991AP), Beta-Actin (Cat. HRP-60008), and secondary antibody Anti-mouse (Cat. SA00002–1) were from Protein Tech, Rosemont, IL. Primary anti- IBA1 (Cat. Ab5076) was procured from Abcam, Cambridge, MA. Secondary anti-rabbit (Cat. 7074S) was from Cell Signal Tech., Danvers, MA and anti-goat Alexa fluor 594 (Cat. A11058) was from Thermo Fisher Scientific Inc., Rockford, IL. Trizol (Cat.15596026) and TaqMan universal master mix reagent (Cat.444040) were from Ambion, Life Technologies, Camarillo, CA.
Srivastava P., Cronin C.G., Scranton V.L., Jacobson K.A., Liang B.T, & Verma R. (2020). Neuroprotective and Neuro-rehabilitative Effects of Acute Purinergic Receptor P2X4 (P2X4R) Blockade after Ischemic Stroke. Experimental neurology, 329, 113308.
+ Open protocol
+ Expand
8

DNA Extraction and Genotyping Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total genomic DNA was obtained using a commercial extraction kit (QIAamp DNA Mini Kit, Qiagen, Brazil). Genotyping reactions were performed using real-time PCR (qPCR) with TaqMan® Universal Master Mix reagent and a specific assay for the rs495366 SNP polymorphism from Thermo Fisher (Massachusetts, USA) based on the stem-loop method. Settings for qPCR started with 50°C for 2 minutes (preread stage) and 95°C for 10 minutes (hold stage) followed by cycling conditions of 95°C for 15 seconds and 60°C for 1 minute for 45 rounds, using the QuantStudio 3 Real-Time PCR System (Thermo Fisher®, Massachusetts, USA).
El-Chaer W.K., Tonet-Furioso A.C., Morais Junior G.S., Souza V.C., Avelar G.G., Henriques A.D., Franco Moraes C, & Nóbrega O.T. (2020). Serum Levels of Matrix Metalloproteinase-1 in Brazilian Patients with Benign Prostatic Hyperplasia or Prostate Cancer. Current Gerontology and Geriatrics Research, 2020, 6012102.
+ Open protocol
+ Expand
9

Genomic DNA Extraction and SNP Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total genomic DNA was obtained using a commercial extraction kit (QIAamp DNA Mini Kit, Qiagen, Brazil). Genotyping reactions were performed using qPCR (real-time PCR) with TaqMan® Universal Master Mix reagent and an assay specific for SNP rs495366 from Thermo Fisher (Massachusetts, USA), with probes designed to detected the flanking regions and the polymorphic variation based on the TTGACCTAAATTTCTGCAAACTATA[R]TCTTATGGTTATGACTCTTTTTGT sequence. The denaturation/extension times and number of cycles used followed the standard program on the equipment used, the QuantStudio 3 Real-Time PCR System (Thermo Fisher®, Massachusetts, USA).
Morais Junior G.S., Rodrigues N.O., Henriques A.D., Tonet-Furioso A.C., Brito C.J., Gomes L.O., Moraes C.F, & Nóbrega O.T. (2018). Matrix Metalloproteinase-1 Gene Polymorphism Associated with Ultrasound-Assessed Carotid Thickness among Older Adults. Journal of Aging Research, 2018, 1475890.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!