Pcr purification kit

Manufactured by Agilent Technologies

The PCR purification kit is a laboratory tool designed to isolate and purify DNA fragments from PCR (Polymerase Chain Reaction) amplification reactions. The kit utilizes a silica-based membrane technology to selectively bind DNA, allowing for the removal of unwanted components such as primers, nucleotides, and enzymes. This purification process enables the recovery of high-quality DNA samples suitable for downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Chip assay kit, by Merck Group (2 mentions) Protease inhibitor cocktail, by Merck Group (2 mentions) 48.48 access array ifc, by Standard BioTools (1 mentions) Dna1000 bioanalyzer chip, by Agilent Technologies (1 mentions) Agilent brilliant ultra fast sybr green qpcr reagent, by Agilent Technologies (1 mentions) Nextseq 550, by Illumina (1 mentions) Tapestation 2200, by Agilent Technologies (1 mentions) Kapa library quant kit, by Roche (1 mentions) High sensitivity d1000 screentape, by Agilent Technologies (1 mentions) Tg nextseq 500 550 high output kit v2, by Illumina (1 mentions) Nebnext high fidelity 2x pcr master mix, by New England Biolabs (1 mentions)

Spelling variants of this product

Strataprep PCR purification kit (9 citations) QIAquick PCR Purification Kit (7 citations)

4 protocols using pcr purification kit

Amplification and Sequencing of Genomic DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA templates were amplified using the 48.48 Access Array IFC, according to the manufacturer’s instructions (Fluidigm). Briefly, 48 DNA samples were combined with the 48 multiplex primers pairs on a microfluidic IFC-chip. The IFC-chip was loaded with PCR reagents using the Access Array pre-PCR controller loading script and upon completion it was transferred to a thermocycler. After amplification, pooled amplicons from each of the 48 DNA templates were harvested using Access Array post-PCR controller harvesting script, and used as input for the subsequent off-chip PCR reactions, in which each mini-library underwent tagging with sample specific barcodes and attachment of sequencing platform-specific adapters. The output libraries were purified using Qiagen PCR purification kit and analyzed on an Agilent DNA1000 BioAnalyzer chip. The purified combined libraries were sequenced using MiSeq 150 bps pair-end protocol, according to the manufacturers’ standard instructions.

Gal M., Khermesh K., Barak M., Lin M., Lahat H., Reznik Wolf H., Lin M., Pras E, & Levanon E.Y. (2016). Expanding preconception carrier screening for the Jewish population using high throughput microfluidics technology and next generation sequencing. BMC Medical Genomics, 9, 24.

+ Open protocol

+ Expand

ChIP Assay on J-Lat A1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP assay was performed as previously described [24 ,37 (link)]. Briefly, 1X10⁶ J-Lat A1 cells were incubated with PEP005, or PKCδ/θ inhibitor (PKCδi, Millipore/Calbiochem), fixed in 1% formaldehyde then resuspended in lysis buffer containing 1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1 (ChIP Assay Kit, Millipore) and protease inhibitor cocktail (Sigma-Aldrich). Lysates were sonicated to obtain DNA fragments of 200–1500 bp. The immune complex was retrieved by incubating for 45 min with 50 μl of protein A/G-agarose beads saturated with BSA/salmon sperm DNA. Following the washes, the chromatin was eluted and reverse cross-linked overnight. DNA was extracted (Qiagen PCR purification kit) and quantitative real-time PCR was performed using Agilent Brilliant Ultra-Fast SYBR Green QPCR reagent using the 7500 real-time PCR System. The upstream primer sequence was 5’-AGCTTGCTACAAGGGACTTTCC-3’, and the downstream primer sequence was 5’-ACCCAGTACAGGCAAAAAGCAG-3’.

Jiang G., Mendes E.A., Kaiser P., Wong D.P., Tang Y., Cai I., Fenton A., Melcher G.P., Hildreth J.E., Thompson G.R., Wong J.K, & Dandekar S. (2015). Synergistic Reactivation of Latent HIV Expression by Ingenol-3-Angelate, PEP005, Targeted NF-kB Signaling in Combination with JQ1 Induced p-TEFb Activation. PLoS Pathogens, 11(7), e1005066.

+ Open protocol

+ Expand

ChIP Assay for HIV LTR Binding

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The chromatin immunoprecipitation (ChIP) assay was performed as previously described (44 (link), 46 (link), 47 (link)). Briefly, J-Lat A1 cells were fixed in 1% formaldehyde and suspended in lysis buffer containing 1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1 (ChIP assay kit; Millipore), and a protease inhibitor cocktail (Sigma-Aldrich). Lysates were sonicated to obtain DNA fragments of 200 to 1,500 bp. After incubation with anti-ATF4 antibodies (ABE387; EMD-Millipore) overnight, the immune complex was retrieved by incubating lysates for 45 min with 50 µl of protein A/G agarose beads saturated with bovine serum albumin (BSA)-salmon sperm DNA. Following the washes, the chromatin was eluted and reverse cross-linked overnight. DNA was extracted (Qiagen PCR purification kit), and quantitative real-time PCR was performed using Agilent Brilliant Ultra-Fast SYBR green QPCR reagent and the 7500 real-time PCR system. The upstream primer sequence was 5′ AGCTTGCTACAAGGGACTTTCC 3′, and the downstream primer sequence was 5′ ACCCAGTACAGGCAAAAAGCAG 3′. These PCR primers targeted the HIV LTR region (−116 bp to +4 bp).

Jiang G., Santos Rocha C., Hirao L.A., Mendes E.A., Tang Y., Thompson GR I.I.I., Wong J.K, & Dandekar S. (2017). HIV Exploits Antiviral Host Innate GCN2-ATF4 Signaling for Establishing Viral Replication Early in Infection. mBio, 8(3), e01518-16.

+ Open protocol

+ Expand

ATAC-seq Sample Preparation Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

ATACseq sample preparation was performed as described with minor modifications. (Buenrostro et al., 2013 (link)) Sorted cells (2.5-to-5x10⁴) were washed twice in cold PBS and resuspended in 50μl of cold lysis buffer (10nM Tris-HCl, pH 7.4, 10mM NaCl, 3mM MgCl2, 0.1% Tween). Lysates were centrifuge (750xg, 10min, 4°C) and nuclei were resuspended in 50μl of transposition reaction mix (TD buffer [25μl], Tn5 Transposase [2.5μl], nuclease-free water [22.5μl]; (Illumina)) and incubated for 30min at 37°C. Transposed DNA fragments were purified using a QIAGEN Reaction MiniElute Kit, barcoded with NEXTERA dual indexes (Illumina) and amplified by PCR for 11 cycles using NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs). PCR products were purified using a PCR Purification Kit (QIAGEN) and amplified fragments size was verified on a 2200 TapeStation (Agilent Technologies) using High Sensitivity D1000 ScreenTapes (Agilent Technologies). Libraries were quantified by qPCR using a KAPA Library Quant Kit (KAPA Biosystems). Normalized libraries were pooled, diluted to 1.8pg/mL loaded onto a TG NextSeq 500/550 High Output Kit v2 (150 cycles, 400M reads, Illumina) and paired-end sequencing was performed on a NextSeq 550 (Illumina).

Beltra J.C., Manne S., Abdel-Hakeem M.S., Kurachi M., Giles J.R., Chen Z., Casella V., Ngiow S.F., Khan O., Huang Y.J., Yan P., Nzingha K., Xu W., Amaravadi R.K., Xu X., Karakousis G.C., Mitchell T.C., Schuchter L.M., Huang A.C, & Wherry E.J. (2020). Developmental Relationships of Four Exhausted CD8+ T Cell Subsets Reveals Underlying Transcriptional and Epigenetic Landscape Control Mechanisms. Immunity, 52(5), 825-841.e8.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!