Usp5 in 1

Human cell line KGN was purchased from Shanghai BinSui Biological Technology Co., Ltd. KGN was cultured in DMEM basic medium (Gibco, C11995500BT) supplemented with 10% fetal bovine serum (FBS, Sigma-aldrich, F8687), 1% penicillin–streptomycin solution (Gibco, 15140-122), and stored at 37℃ in 5% CO₂.
According to the manufacturer’s instructions, small interfering RNA (si-p62: F: GUCUCCGAUAUCUGUUAAUTT, R: AUUAACAGAUAUCGGAGACTT; si-Usp5: F: GGAGUUCUUCCUUCACCUUTT, R: AAGGUGAAGGAAGAACUCCTT; si-Wt1: F: AAAUUGUCACUGCUGUGUAGGTT, R: CCUACACAGCAGUGACAAUUUTT) was transfected into KGN cells using Lipofectamine 3000 Transfection Kit (Invitrogen, CN2481208) [72 (link)]. All siRNA and negative control siRNA were purchased from GenaPharma (Suzhou, China).
Unless otherwise specified, FSH (National Hormone and Peptide Program, USA; 10 µg/µL) was added to cell culture for 48 h, and other specific drug concentrations were shown as follows. CQ (17,589 A; 10 µM), MG132 (13,259; 10 µM), PR-619 (13,814; 10 µM), USP5-IN-1 (139,979; 7.5 µM) and CHX (12,320; 10 µM) were both purchased from MedChemExpress.

C57BL/6 mice were purchased from the National Institute of Biological Sciences (Beijing, China). We hybridized Foxl2-Cre mice by crossed with p62^flox/flox mice to obtain p62^flox/flox; Foxl2-Cre mice [64 (link)]. Thus, the resulting p62^flox/flox; Foxl2-Cre mice were referred to as p62^−/− mice and p62^flox/flox females were used as control mice, namely p62^+/+ mice. The Foxl2-Cre mice were a gift from Professor Fei Gao, Institute of Zoology, Chinese Academy of Sciences (Beijing, China). Primers to identify knockout mouse genotypes are as follows: p62-seq-F: TGAGAAGGCAGATGGGACAGGGA, p62-seq-R: GCCCAGACATAAGCCACCCACCT; foxl2-Cre-F: TGCTTCTGTCCGTTTGC, foxl2-Cre-F: CCACCGTCAGTACGTGAG. All these mice were housed under controlled temperature (22 °C) and light conditions (14 h light, 10 h darkness; lights on at 07:00 a.m.) and allowed free access to chow and water. The breeding test was performed by crossing p62^+/+ and p62^−/− female mice with proven fertile males for six months. All drugs were injected intraperitoneally, and the concentrations are shown as follows. PR-619 (13,814; 0.12 µg/g [body weight]), USP5-IN-1 (139,979; 0.255 µg/g [body weight]) were both purchased from MedChemExpress [65 ].
All procedures were conducted in accordance with the guidelines of and approved by the Animal Research Committee of the China Agricultural University.