Total RNA was extracted from monocyte lysates using PureLink RNA Mini Kit (Life Technologies) according to manufacturer’s instructions. Quantitative real-time RT-PCR was performed using the OneStep RT-PCR master mix (Qiagen Crawley, UK) according to the manufacturer’s instruction on a Stratagene Mx3000P platform (SABiosciences, Crawley, UK) using 15µg of RNA per sample. To determine the quantitative change in RNA, standard curves were prepared from a known concentration of the genes of interest and subjected to real-time PCR as above. MMP-1 primers and probes were custom made and supplied by Sigma-Aldrich (forward primer: 5’- AAGATGAAAGGTGGACCAACAATT -3’; reverse primer: 5’-CCAAGAGAATGGCCGAGTTC-3’; probe: 5’- FAM-CAGAGAGTACAACTTACATCGTGTTGCGGCTC-TAMRA-3’) and 18S rRNA primer and probe mix was supplied by Life Technologies.
Stratagene mx3000p platform
Manufactured by Qiagen
Sourced in United Kingdom
The Stratagene Mx3000P platform is a real-time PCR (polymerase chain reaction) detection system designed for quantitative gene expression analysis. It features a compact, flexible design and supports multiple detection formats, including SYBR Green, hydrolysis probes, and molecular beacons. The Mx3000P platform is capable of performing high-throughput analysis and provides precise data collection and analysis tools.
Automatically generated - may contain errors
2 protocols using stratagene mx3000p platform
1
Quantitative Real-Time RT-PCR for MMP-1 Expression
2
Quantitative RT-PCR analysis of MMP-1 expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from monocyte lysates using PureLink RNA Mini Kit (Life Technologies) according to the manufacturer’s instructions. Quantitative real-time RT-PCR was performed using the OneStep RT-PCR Master Mix (Qiagen, Crawley, U.K.) according to the manufacturer’s instruction on a Stratagene Mx3000P platform (SABiosciences, Crawley, U.K.) using 15 μg of RNA per sample. To determine the quantitative change in RNA, standard curves were prepared from a known concentration of the genes of interest and subjected to real-time PCR as above. MMP-1 primers and probes were custom made and supplied by Sigma-Aldrich (forward primer: 5′-AAGATGAAAGGTGGACCAACAATT-3′; reverse primer: 5′-CCAAGAGAATGGCCGAGTTC-3′; probe: 5′-FAM-CAGAGAGTACAACTTACATCGTGTTGCGGCTC-TAMRA-3′), and 18S rRNA primer and probe mix was supplied by Life Technologies.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!