NK precursors (stage 1 and stage 2) were sorted according to their expression profiles described in supplementary figure 4a . Total RNA was extracted using RNeasy Micro Kit (Qiagen). The quality of the RNA obtained was evaluated using the Laboratory-Chip technique (Agilent Bioanalyzer) and subsequently preamplified according to the Ambion WTA expression protocol (Thermo Fischer). RNA was reverse transcribed into cDNA using the iScript protocol (Bio-Rad). QT-PCR was performed using the SsoAdvanced™ Universal SYBR® Green Supermix (BIO-RAD) and the MyCycler Thermal cycler system (Bio-Rad).Used primers: mNKG2D-S FW: AGTTGAGTTGAAGGCTTTGACTC, mNKG2D-S REV: ACTTTGCTGGCTTGAGGTC, DAP12 FW: GACTGTGGGAGGATTAAGTCC, DAP12 REV: AACACCAAGTCACCCAGAAC.
Laboratory chip technique
Manufactured by Agilent Technologies
The Laboratory-Chip technique is an analytical method that utilizes a miniaturized platform to perform various laboratory operations. It allows for the integration of multiple analytical processes on a single, compact device. The core function of this technique is to enable rapid and efficient analysis of small-volume samples, with applications in fields such as chemistry, biology, and diagnostics.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using laboratory chip technique
1
NK Precursor Gene Expression Analysis
2
NK Precursor Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NK precursors (stage 1 and stage 2) were sorted according to their expression profiles described in supplementary figure 4a . Total RNA was extracted using RNeasy Micro Kit (Qiagen). The quality of the RNA obtained was evaluated using the Laboratory-Chip technique (Agilent Bioanalyzer) and subsequently preamplified according to the Ambion WTA expression protocol (Thermo Fischer). RNA was reverse transcribed into cDNA using the iScript protocol (Bio-Rad). QT-PCR was performed using the SsoAdvanced™ Universal SYBR® Green Supermix (BIO-RAD) and the MyCycler Thermal cycler system (Bio-Rad).Used primers: mNKG2D-S FW: AGTTGAGTTGAAGGCTTTGACTC, mNKG2D-S REV: ACTTTGCTGGCTTGAGGTC, DAP12 FW: GACTGTGGGAGGATTAAGTCC, DAP12 REV: AACACCAAGTCACCCAGAAC.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!